Profile of regulator BDP_1267 in Bifidobacteriaceae
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Regulog: | BDP_1267 - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium breve DSM 20213 | |||||
| BIFBRE_00098 | BDP_1267 | -226 | 6 | TCATTAGAACGTTCAAATAA | |
| BIFBRE_00099 | BDP_1268 | -86 | 6 | TTATTTGAACGTTCTAATGA | |
| Bifidobacterium dentium Bd1 | |||||
| BDP_1267 | BDP_1267 | -210 | 5.8 | TAATTAGAACGTTCTAATTT | |
| BDP_1268 | BDP_1268 | -50 | 5.8 | AAATTAGAACGTTCTAATTA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |