Regulog BDP_1267 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 5 | 2 |
| Bifidobacterium dentium Bd1 | 5 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| BDP_1267 |
|
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -226 score = 5.95205 sequence = TCATTAGAACGTTCAAATAA Gene: BIFBRE_00098: Transcriptional regulator, LacI family |
*
Bifidobacterium dentium Bd1 Site: position = -210 score = 5.83497 sequence = TAATTAGAACGTTCTAATTT Gene: BDP_1267: Transcriptional regulator, LacI family |
|
|
|
Transcriptional regulator, LacI family |
| CRON 2. | |||||||||||
| BDP_1268 |
|
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -86 score = 5.95205 sequence = TTATTTGAACGTTCTAATGA Gene: BIFBRE_00099: Putative carbohydrate ABC transporter, solute-binding protein |
*
Bifidobacterium dentium Bd1 Site: position = -50 score = 5.83497 sequence = AAATTAGAACGTTCTAATTA Gene: BDP_1268: Putative carbohydrate ABC transporter, solute-binding protein |
|
|
|
Putative carbohydrate ABC transporter, solute-binding protein |
| BDP_1269 |
|
|
|
|
|
Gene: BIFBRE_00100: Putative carbohydrate ABC transporter, permease protein 2 |
Gene: BDP_1269: Putative carbohydrate ABC transporter, permease protein 2 |
|
|
|
Putative carbohydrate ABC transporter, permease protein 2 |
| BDP_1270 |
|
|
|
|
|
Gene: BIFBRE_00101: Putative carbohydrate ABC transporter, permease protein |
Gene: BDP_1270: Putative carbohydrate ABC transporter, permease protein |
|
|
|
Putative carbohydrate ABC transporter, permease protein |
| BDP_1271 |
|
|
|
|
|
Gene: BIFBRE_00102: Putative amylo-alpha-1,6-glucosidase |
Gene: BDP_1271: Putative amylo-alpha-1,6-glucosidase |
|
|
|
Putative amylo-alpha-1,6-glucosidase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |