Regulon of RspR in Chromohalobacter salexigens DSM 3043

Properties
Regulator type:	Transcription factor
TF locus tag:	Csal_2973
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	L-gulonate utilization
Effector:	L-gulonate; D-mannonate
Regulog:	RspR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - GntR/Others
By effector - L-gulonate
By effector - D-mannonate
By pathway - L-gulonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -46 Score: 6.2 Sequence: CCAACTACCATACTAGTCAG Locus tag: Csal_2973 Name: rspR Funciton: Transcriptional regulator for L-gulonate utilization, GntR family Locus tag: Csal_2974 Name: rspA Funciton: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family Locus tag: Csal_2975 Name: rspB Funciton: L-gulonate dehydrogenase, COG1063 family Locus tag: Csal_2976 Name: rspP Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component Locus tag: Csal_2977 Name: rspQ Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component Locus tag: Csal_2978 Name: rspM Funciton: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component Locus tag: Csal_2979 Name: rspD Funciton: D-mannonate oxidoreductase (EC 1.1.1.57) Locus tag: Csal_2980 Name: uxuA Funciton: Mannonate dehydratase (EC 4.2.1.8)
	Csal_2973	rspR	Transcriptional regulator for L-gulonate utilization, GntR family
	Csal_2974	rspA	D-mannonate dehydratase (EC 4.2.1.8), COG4948 family
	Csal_2975	rspB	L-gulonate dehydrogenase, COG1063 family
	Csal_2976	rspP	L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component
	Csal_2977	rspQ	L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component
	Csal_2978	rspM	L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component
	Csal_2979	rspD	D-mannonate oxidoreductase (EC 1.1.1.57)
	Csal_2980	uxuA	Mannonate dehydratase (EC 4.2.1.8)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD