Regulog RspR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | L-gulonate utilization |
| Effector: | L-gulonate; D-mannonate |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - GntR/Others
- By effector - L-gulonate
- By effector - D-mannonate
- By pathway - L-gulonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Alcanivorax borkumensis SK2 | ||
| Chromohalobacter salexigens DSM 3043 | 8 | 1 |
| Hahella chejuensis KCTC 2396 | ||
| Marinomonas sp. MWYL1 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Reinekea sp. MED297 | ||
| Cellvibrio japonicus Ueda107 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| rspR |
|
*
Chromohalobacter salexigens DSM 3043 Site: position = -46 score = 6.20975 sequence = CCAACTACCATACTAGTCAG Gene: Csal_2973: Transcriptional regulator for L-gulonate utilization, GntR family |
|
|
|
|
|
|
|
|
|
|
Transcriptional regulator for L-gulonate utilization, GntR family |
| rspA |
|
Gene: Csal_2974: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
|
Gene: Mmwyl1_0037: D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
|
|
|
|
|
|
|
|
D-mannonate dehydratase (EC 4.2.1.8), COG4948 family |
| rspB |
|
Gene: Csal_2975: L-gulonate dehydrogenase, COG1063 family |
|
Gene: Mmwyl1_0038: L-gulonate dehydrogenase, COG1063 family |
|
|
|
|
|
|
|
|
L-gulonate dehydrogenase, COG1063 family |
| rspP |
|
Gene: Csal_2976: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component |
|
Gene: Mmwyl1_0043: L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component |
|
|
|
|
|
|
|
|
L-gulonate/D-mannonate-specific TRAP-type transport system, periplasmic component |
| rspQ |
|
Gene: Csal_2977: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component |
|
Gene: Mmwyl1_0044: L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component |
|
|
|
|
|
|
|
|
L-gulonate/D-mannonate-specific TRAP-type transport system, small permease component |
| rspM |
|
Gene: Csal_2978: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component |
|
Gene: Mmwyl1_0045: L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component |
|
|
|
|
|
|
|
|
L-gulonate/D-mannonate-specific TRAP-type transport system, large permease component |
| rspD |
|
Gene: Csal_2979: D-mannonate oxidoreductase (EC 1.1.1.57) |
|
|
|
|
|
|
|
|
|
|
D-mannonate oxidoreductase (EC 1.1.1.57) |
| uxuA |
|
Gene: Csal_2980: Mannonate dehydratase (EC 4.2.1.8) |
|
|
|
|
|
|
|
|
|
|
Mannonate dehydratase (EC 4.2.1.8) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |