Profile of regulator RspR in Oceanospirillales/Alteromonadales
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | L-gulonate utilization |
| Effector: | L-gulonate; D-mannonate |
| Regulog: | RspR - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - GntR/Others
- By effector - L-gulonate
- By effector - D-mannonate
- By pathway - L-gulonate utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Chromohalobacter salexigens DSM 3043 | |||||
| Csal_2973 | rspR | -46 | 6.2 | CCAACTACCATACTAGTCAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |