Regulon of MntR in Enterococcus faecium DO

Properties
Regulator type:	Transcription factor
TF locus tag:	EfaeDRAFT_2210
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Enterococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Enterococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.9 Sequence: AAAGTTAGGTAAACCTAAAAAG Locus tag: EfaeDRAFT_2039 Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein Locus tag: EfaeDRAFT_2038 Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein Locus tag: EfaeDRAFT_2037 Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein
	EfaeDRAFT_2039	mntA	Manganese ABC transporter, ATP-binding protein
	EfaeDRAFT_2038	mntB	Manganese ABC transporter, inner membrane permease protein
	EfaeDRAFT_2037	mntC	Manganese ABC transporter, periplasmic-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD