Regulon of MntR in Enterococcus faecium DO
| Regulator type: | Transcription factor |
| TF locus tag: | EfaeDRAFT_2210 |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Regulog: | MntR - Enterococcaceae |
| Statistics of regulated genes: | |
| - Genes | 3 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterococcaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -33
Score: 5.9 Sequence: AAAGTTAGGTAAACCTAAAAAG
Locus tag: EfaeDRAFT_2039
Name: mntA Funciton: Manganese ABC transporter, ATP-binding protein
Locus tag: EfaeDRAFT_2038
Name: mntB Funciton: Manganese ABC transporter, inner membrane permease protein
Locus tag: EfaeDRAFT_2037
Name: mntC Funciton: Manganese ABC transporter, periplasmic-binding protein |
|||
|
mntA
|
Manganese ABC transporter, ATP-binding protein
|
||
|
mntB
|
Manganese ABC transporter, inner membrane permease protein
|
||
|
mntC
|
Manganese ABC transporter, periplasmic-binding protein
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |