Regulog MntR - Enterococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterococcaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Enterococcus faecalis V583 | 8 | 4 |
| Enterococcus faecium DO | 3 | 1 |
| Genes | Function | ||
|---|---|---|---|
| CRON 1. | |||
| mntH |
*2
Enterococcus faecalis V583 Site: position = -57 score = 5.99056 sequence = ATTTTTAGGTGTGCCTAAAAGT Gene: EF1901: Manganese transport protein, NRAMP family Site: position = -90 score = 6.63446 sequence = TATTTTAGGTGTACCTAAAATA Gene: EF1057: Manganese transport protein, NRAMP family |
|
Manganese transport protein, NRAMP family |
| CRON 2. | |||
| mntA |
*2
Enterococcus faecalis V583 Site: position = -78 score = 6.00761 sequence = AAATTTAGGCTTGACTAAAATA Gene: EF0575: Manganese ABC transporter, ATP-binding protein Site: position = -88 score = 6.12999 sequence = GTATTTAGGTGCGCCTAAAAAT Site: position = -33 score = 5.75931 sequence = ATTTTAAGGCAAACCTAAAAAA Gene: EF2074: Manganese ABC transporter, ATP-binding protein |
*
Enterococcus faecium DO Site: position = -33 score = 5.93014 sequence = AAAGTTAGGTAAACCTAAAAAG Gene: EfaeDRAFT_2039: Manganese ABC transporter, ATP-binding protein |
Manganese ABC transporter, ATP-binding protein |
| mntB |
2
Enterococcus faecalis V583 Gene: EF2075: Manganese ABC transporter, inner membrane permease protein Gene: EF0576: Manganese ABC transporter, inner membrane permease protein |
Gene: EfaeDRAFT_2038: Manganese ABC transporter, inner membrane permease protein |
Manganese ABC transporter, inner membrane permease protein |
| mntC |
2
Enterococcus faecalis V583 Gene: EF0577: Manganese ABC transporter, periplasmic-binding protein Gene: EF2076: Manganese ABC transporter, periplasmic-binding protein |
Gene: EfaeDRAFT_2037: Manganese ABC transporter, periplasmic-binding protein |
Manganese ABC transporter, periplasmic-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |