Regulon of TtrR in Pasteurella multocida subsp. multocida str. Pm70

Properties
Regulator type:	Transcription factor
TF locus tag:	PM0725
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Pasteurellales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -107 Score: 6.5 Sequence: GTTTATGTGGAAAACCACAATAGT Locus tag: PM0723 Name: ttrB Funciton: Tetrathionate reductase subunit B Locus tag: PM0722 Name: ttrC Funciton: Tetrathionate reductase subunit C Locus tag: PM0721 Name: ttrA Funciton: Tetrathionate reductase subunit A
	PM0723	ttrB	Tetrathionate reductase subunit B
	PM0722	ttrC	Tetrathionate reductase subunit C
	PM0721	ttrA	Tetrathionate reductase subunit A
Position: -64 Score: 6.5 Sequence: ACTATTGTGGTTTTCCACATAAAC Locus tag: PM0724 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: PM0725 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	PM0724	ttrS	Tetrathionate reduction sensor protein TtrS
	PM0725	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD