Regulon of TtrR in Haemophilus somnus 2336

Properties
Regulator type:	Transcription factor
TF locus tag:	HSM_1379
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Tetrathionate reduction
Effector:	Tetrathionate
Regulog:	TtrR - Pasteurellales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By trascription factor - TtrR
By TF family - LuxR
By effector - Tetrathionate
By pathway - Tetrathionate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -179 Score: 6.4 Sequence: TTTTATGTGGAAAACCACAATGGT Locus tag: HSM_1377 Name: ttrB Funciton: Tetrathionate reductase subunit B Locus tag: HSM_1376 Name: ttrC Funciton: Tetrathionate reductase subunit C Locus tag: HSM_1375 Name: ttrA Funciton: Tetrathionate reductase subunit A
	HSM_1377	ttrB	Tetrathionate reductase subunit B
	HSM_1376	ttrC	Tetrathionate reductase subunit C
	HSM_1375	ttrA	Tetrathionate reductase subunit A
Position: -96 Score: 6.4 Sequence: ACCATTGTGGTTTTCCACATAAAA Locus tag: HSM_1378 Name: ttrS Funciton: Tetrathionate reduction sensor protein TtrS Locus tag: HSM_1379 Name: ttrR Funciton: Tetrathionate reduction response regulator protein TtrR, LuxR family
	HSM_1378	ttrS	Tetrathionate reduction sensor protein TtrS
	HSM_1379	ttrR	Tetrathionate reduction response regulator protein TtrR, LuxR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD