Regulon of PhsR in Shewanella sp W3-18-1
| Regulator type: | Transcription factor |
| TF locus tag: | Sputw3181_3638 |
| Regulator family: | LuxR |
| Regulation mode: | activator |
| Biological process: | Thiosulfate reduction |
| Effector: | Thiosulfate |
| Regulog: | PhsR - Shewanellaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - PhsR
- By TF family - LuxR
- By effector - Thiosulfate
- By pathway - Thiosulfate reduction
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -2483
Score: 6.6 Sequence: CCCTATGTGGTTTACCACAATATC
Locus tag: Sputw3181_3558
Name: phsB Funciton: Thiosulfate reductase electron transport protein phsB
Locus tag: Sputw3181_3557
Name: phsC Funciton: Thiosulfate reductase cytochrome B subunit |
|||
|
phsB
|
Thiosulfate reductase electron transport protein phsB
|
||
|
phsC
|
Thiosulfate reductase cytochrome B subunit
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |