Regulon of PhsR in Shewanella putrefaciens CN-32
Regulator type: | Transcription factor |
TF locus tag: | Sputcn32_0534 |
Regulator family: | LuxR |
Regulation mode: | activator |
Biological process: | Thiosulfate reduction |
Effector: | Thiosulfate |
Regulog: | PhsR - Shewanellaceae |
Statistics of regulated genes: | |
- Genes | 2 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - PhsR
- By TF family - LuxR
- By effector - Thiosulfate
- By pathway - Thiosulfate reduction
Locus Tag | Name | Function | |
---|---|---|---|
Position: -2484
Score: 6.6 Sequence: CCCTATGTGGTTTACCACAATATC
Locus tag: Sputcn32_0612
Name: phsB Funciton: Thiosulfate reductase electron transport protein phsB
Locus tag: Sputcn32_0613
Name: phsC Funciton: Thiosulfate reductase cytochrome B subunit |
|||
phsB
|
Thiosulfate reductase electron transport protein phsB
|
||
phsC
|
Thiosulfate reductase cytochrome B subunit
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |