Regulon of PhsR in Shewanella frigidimarina NCIMB 400

Properties
Regulator type:	Transcription factor
TF locus tag:	Sfri_1997
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	PhsR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PhsR
By TF family - LuxR
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -154 Score: 6.5 Sequence: CTCAATGTGGTTTACCACAATACC Locus tag: Sfri_1999 Name: phsA Funciton: Thiosulfate reductase precursor (EC 1.-.-.-) Locus tag: Sfri_2000 Name: phsB Funciton: Thiosulfate reductase electron transport protein phsB Locus tag: Sfri_2001 Name: phsC Funciton: Thiosulfate reductase cytochrome B subunit
	Sfri_1999	phsA	Thiosulfate reductase precursor (EC 1.-.-.-)
	Sfri_2000	phsB	Thiosulfate reductase electron transport protein phsB
	Sfri_2001	phsC	Thiosulfate reductase cytochrome B subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD