Regulon of PhsR in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_3183
Regulator family:	LuxR
Regulation mode:	activator
Biological process:	Thiosulfate reduction
Effector:	Thiosulfate
Regulog:	PhsR - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PhsR
By TF family - LuxR
By effector - Thiosulfate
By pathway - Thiosulfate reduction

Regulated operons
	Locus Tag	Name	Function
Position: -135 Score: 6.1 Sequence: CGCTATGTGGTTTTCCACAATATC Locus tag: Sama_3177 Name: phsA Funciton: Thiosulfate reductase precursor (EC 1.-.-.-) Locus tag: Sama_3176 Name: phsB Funciton: Thiosulfate reductase electron transport protein phsB Locus tag: Sama_3175 Name: phsC Funciton: Thiosulfate reductase cytochrome B subunit
	Sama_3177	phsA	Thiosulfate reductase precursor (EC 1.-.-.-)
	Sama_3176	phsB	Thiosulfate reductase electron transport protein phsB
	Sama_3175	phsC	Thiosulfate reductase cytochrome B subunit

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD