Regulon of PaaR in Streptomyces avermitilis MA-4680

Properties
Regulator type:	Transcription factor
TF locus tag:	SAV_4360
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Streptomycetaceae
Statistics of regulated genes:
- Genes	12
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5 Sequence: GGCTACCGAATGATCGGTCGCC Locus tag: SAV_1257 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	SAV_1257	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -48 Score: 5.8 Sequence: ACCGAACGATCGGTCGGTCGGT Locus tag: SAV_4354 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: SAV_4353 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: SAV_4352 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: SAV_4351 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: SAV_4350 Name: paaE Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
	SAV_4354	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	SAV_4353	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	SAV_4352	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	SAV_4351	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	SAV_4350	paaE	Phenylacetate-CoA oxygenase, PaaE subunit
Position: -96 Score: 5.8 Sequence: CCCGACCGATCGTTCGGTTACT Locus tag: SAV_4358 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	SAV_4358	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -77 Score: 5.6 Sequence: GACGACCGAACAATCGGTAGGT Locus tag: SAV_4362 Name: bkdA Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) Locus tag: SAV_4363 Name: bkdB Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) Locus tag: SAV_4364 Name: bkdC Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
	SAV_4362	bkdA	Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
	SAV_4363	bkdB	Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
	SAV_4364	bkdC	Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
Position: -74 Score: 5.8 Sequence: AGTAACCGAACGATCGGTCGGG Locus tag: SAV_4359 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: SAV_4360 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	SAV_4359	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	SAV_4360	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD