Regulon of PaaR in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO3833
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Streptomycetaceae
Statistics of regulated genes:
- Genes	13
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 24 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By trascription factor - PaaR
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -74 Score: 5.8 Sequence: AGTAACCGAACGATCGGTCGGG Locus tag: SCO3834 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: SCO3833 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	SCO3834	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	SCO3833	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -152 Score: 5.5 Sequence: CCCAACCGACCATTCGTTCGGT Position: -29 Score: 5.6 Sequence: GCTAACCGAATGGTCGGTCGGG Locus tag: SCO7470 Name: paaI Funciton: Phenylacetic acid degradation protein PaaI, thioesterase Locus tag: SCO7469 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	SCO7470	paaI	Phenylacetic acid degradation protein PaaI, thioesterase
	SCO7469	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Position: -157 Score: 5.6 Sequence: CCCGACCGACCATTCGGTTAGC Position: -34 Score: 5.5 Sequence: ACCGAACGAATGGTCGGTTGGG Locus tag: SCO7471 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: SCO7472 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: SCO7473 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: SCO7474 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: SCO7475 Name: paaE Funciton: Phenylacetate-CoA oxygenase, PaaE subunit
	SCO7471	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	SCO7472	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	SCO7473	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	SCO7474	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	SCO7475	paaE	Phenylacetate-CoA oxygenase, PaaE subunit
Position: -106 Score: 5.8 Sequence: CCCGACCGATCGTTCGGTTACT Locus tag: SCO3835 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	SCO3835	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Position: -78 Score: 5.6 Sequence: GACGACCGAACAATCGGTAGGT Locus tag: SCO3831 Name: bkdA Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4) Locus tag: SCO3830 Name: bkdB Funciton: Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4) Locus tag: SCO3829 Name: bkdC Funciton: Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)
	SCO3831	bkdA	Branched-chain alpha-keto acid dehydrogenase, E1 component, alpha subunit (EC 1.2.4.4)
	SCO3830	bkdB	Branched-chain alpha-keto acid dehydrogenase, E1 component, beta subunit (EC 1.2.4.4)
	SCO3829	bkdC	Dihydrolipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex (EC 2.3.1.168)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD