Regulon of ArsR in Rhodococcus sp. RHA1

Properties
Regulator type:	Transcription factor
TF locus tag:	RHA1_ro03367
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Arsenic resistance
Effector:	Arsenite; Arsenate
Regulog:	ArsR - Nocardiaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By TF family - ArsR
By effector - Arsenite
By effector - Arsenate
By pathway - Arsenic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -13 Score: 7.1 Sequence: TCAATATCGACGCATGTCGA Locus tag: RHA1_ro03367 Name: arsR Funciton: Arsenical resistance operon repressor, ArsR family Locus tag: RHA1_ro03368 Name: arsB Funciton: Arsenate reductase (EC 1.20.4.1) Locus tag: RHA1_ro03369 Name: arsC Funciton: Arsenate reductase (EC 1.20.4.1)
	RHA1_ro03367	arsR	Arsenical resistance operon repressor, ArsR family
	RHA1_ro03368	arsB	Arsenate reductase (EC 1.20.4.1)
	RHA1_ro03369	arsC	Arsenate reductase (EC 1.20.4.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD