Regulon of CzrA in Eubacterium eligens ATCC 27750

Properties
Regulator type:	Transcription factor
TF locus tag:	EUBELI_01432
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Zinc resistance; Nickel resistance; Copper resistance; Cobalt resistance; Cadmium resistance
Effector:	Zinc ion, (Zn2+); Silver ion, (Ag+); Nickel ion, (Ni2+); Copper ion, (Cu2+); Cobalt ion, (Co2+); Cadmium, ion (Cd2+)
Regulog:	CzrA - Clostridia-3
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By trascription factor - CzrA
By TF family - ArsR
By effector - Zinc ion, (Zn2+)
By effector - Silver ion, (Ag+)
By effector - Nickel ion, (Ni2+)
By effector - Copper ion, (Cu2+)
By effector - Cobalt ion, (Co2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Zinc resistance
By pathway - Nickel resistance
By pathway - Copper resistance
By pathway - Cobalt resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 7.3 Sequence: CATATGAATGAATGTTCATATG Locus tag: EUBELI_01434 Name: PF00403 Funciton: Heavy-metal-associated domain Locus tag: EUBELI_01433 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: EUBELI_01432 Name: czrA Funciton: Cadmium-dependent transcriptuin regulator, ArsR family
	EUBELI_01434	PF00403	Heavy-metal-associated domain
	EUBELI_01433	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
	EUBELI_01432	czrA	Cadmium-dependent transcriptuin regulator, ArsR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD