Regulon of AmtR in Mycobacterium abscessus ATCC 19977

Properties
Regulator type:	Transcription factor
TF locus tag:	MAB_4089c
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Nitrogen metabolism
Effector:	GlnK-AMP, signal transduction protein
Regulog:	AmtR - Mycobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By trascription factor - AmtR
By TF family - TetR
By effector - GlnK-AMP, signal transduction protein
By pathway - Nitrogen metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 5.9 Sequence: TTTACCTATCGCCTGACAGATATT Locus tag: MAB_4090 Name: uctT Funciton: Urea carboxylase-related transporter, Amino acid permease family Locus tag: MAB_4091 Name: amt1 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: MAB_4092 Name: amt2 Funciton: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) Locus tag: MAB_4093 Name: ucaA Funciton: Urea carboxylase (EC 6.3.4.6)
	MAB_4090	uctT	Urea carboxylase-related transporter, Amino acid permease family
	MAB_4091	amt1	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	MAB_4092	amt2	Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10)
	MAB_4093	ucaA	Urea carboxylase (EC 6.3.4.6)
Position: -183 Score: 5.9 Sequence: AATATCTGTCAGGCGATAGGTAAA Locus tag: MAB_4089c Name: amtR Funciton: Transcriptional regulator of urea utilization, TetR family
	MAB_4089c	amtR	Transcriptional regulator of urea utilization, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD