Regulog AmtR - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Nitrogen metabolism |
| Effector: | GlnK-AMP, signal transduction protein |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By trascription factor - AmtR
- By TF family - TetR
- By effector - GlnK-AMP, signal transduction protein
- By pathway - Nitrogen metabolism
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium smegmatis str. MC2 155 | 5 | 1 |
| Mycobacterium tuberculosis H37Rv | ||
| Mycobacterium abscessus ATCC 19977 | 5 | 2 |
| Mycobacterium avium 104 | ||
| Mycobacterium marinum M | ||
| Mycobacterium leprae TN | ||
| Mycobacterium vanbaalenii PYR-1 | ||
| Mycobacterium flavescens PYR-GCK | ||
| Mycobacterium sp. JLS | 5 | 2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| amtR |
Gene: MSMEG_4300: Transcriptional regulator of urea utilization, TetR family |
|
*
Mycobacterium abscessus ATCC 19977 Site: position = -183 score = 5.85042 sequence = AATATCTGTCAGGCGATAGGTAAA Gene: MAB_4089c: Transcriptional regulator of urea utilization, TetR family |
|
|
|
|
|
*
Mycobacterium sp. JLS Site: position = -67 score = 6.26577 sequence = CGTTTCTGTCGTGTGACAGAAACC Gene: Mjls_1823: Transcriptional regulator of urea utilization, TetR family |
Transcriptional regulator of urea utilization, TetR family |
| CRON 2. | ||||||||||
| uctT |
*
Mycobacterium smegmatis str. MC2 155 Site: position = -60 score = 6.59364 sequence = GTTATCTGTCATCTGACAGGTAAG Gene: MSMEG_2184: Urea carboxylase-related transporter, Amino acid permease family |
|
*
Mycobacterium abscessus ATCC 19977 Site: position = -101 score = 5.85042 sequence = TTTACCTATCGCCTGACAGATATT Gene: MAB_4090: Urea carboxylase-related transporter, Amino acid permease family |
|
|
|
|
|
|
Urea carboxylase-related transporter, Amino acid permease family |
| amt1 |
Gene: MSMEG_2185: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
Gene: MAB_4091: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
|
|
*
Mycobacterium sp. JLS Site: position = -116 score = 5.4333 sequence = AAAACCTGTCACATGACAGACACA Site: position = -21 score = 6.17041 sequence = GAAAACTGTCAGGTGACAGAAATG Gene: Mjls_1819: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| amt2 |
Gene: MSMEG_2186: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
Gene: MAB_4092: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
|
|
|
|
|
Gene: Mjls_1820: Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
Urea carboxylase-related aminomethyltransferase (EC 2.1.2.10) |
| ucaA |
Gene: MSMEG_2187: Urea carboxylase (EC 6.3.4.6) |
|
Gene: MAB_4093: Urea carboxylase (EC 6.3.4.6) |
|
|
|
|
|
Gene: Mjls_1821: Urea carboxylase (EC 6.3.4.6) |
Urea carboxylase (EC 6.3.4.6) |
| ucaB |
Gene: MSMEG_2189: Allophanate hydrolase (EC 3.5.1.54) |
|
Gene: MAB_1558c: Allophanate hydrolase (EC 3.5.1.54) |
|
|
|
|
|
Gene: Mjls_1822: Allophanate hydrolase (EC 3.5.1.54) |
Allophanate hydrolase (EC 3.5.1.54) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |