Regulon of SO3277 in Shewanella putrefaciens CN-32

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputcn32_2634
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Regulog:	SO3277 - Shewanellaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 5.6 Sequence: ACTAGACTTGTTAGTCTAGA Position: -70 Score: 6.7 Sequence: ACTAGACTGTCTAGTCTATT Locus tag: Sputcn32_2634 Name: SO3277 Funciton: Transcriptional regulator, TetR family
	Sputcn32_2634	SO3277	Transcriptional regulator, TetR family
Position: -88 Score: 6.7 Sequence: AATAGACTAGACAGTCTAGT Position: -60 Score: 5.6 Sequence: TCTAGACTAACAAGTCTAGT Locus tag: Sputcn32_2635 Name: SO3278 Funciton: RND family efflux transporter MFP subunit Locus tag: Sputcn32_2636 Name: SO3279 Funciton: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family
	Sputcn32_2635	SO3278	RND family efflux transporter MFP subunit
	Sputcn32_2636	SO3279	acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD