Regulog SO3277 - Shewanellaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Multidrug resistance
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 64 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Multidrug resistance

Statistics of regulated genes
Genome	Genes	Operons
Shewanella oneidensis MR-1	3	2
Shewanella putrefaciens CN-32	3	2
Shewanella sp W3-18-1	3	2
Shewanella sp ANA-3	3	2
Shewanella sp MR-4	3	2
Shewanella sp MR-7	3	2
Shewanella baltica OS155	3	2
Shewanella denitrificans OS217	3	2
Shewanella frigidimarina NCIMB 400	3	2
Shewanella amazonensis SB2B	3	2
Shewanella loihica PV-4	3	2
Shewanella pealeana ATCC 700345	3	2
Shewanella halifaxensis HAW-EB4	3	2
Shewanella piezotolerans WP3	3	2
Shewanella sediminis HAW-EB3	3	2
Shewanella woodyi ATCC 51908	3	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																	Function

CRON 1.
SO3278	* Shewanella oneidensis MR-1 Site: position = -60 score = 6.54801 sequence = ACTAGACTAGCAAGTCTAGT Site: position = -88 score = 6.11387 sequence = AATGGACTAGACAGTCCAGT Gene: SO_3278: RND family efflux transporter MFP subunit	* Shewanella putrefaciens CN-32 Site: position = -60 score = 5.56067 sequence = TCTAGACTAACAAGTCTAGT Site: position = -88 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Gene: Sputcn32_2635: RND family efflux transporter MFP subunit	* Shewanella sp W3-18-1 Site: position = -60 score = 5.56067 sequence = TCTAGACTAACAAGTCTAGT Site: position = -88 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Gene: Sputw3181_1372: RND family efflux transporter MFP subunit	* Shewanella sp ANA-3 Site: position = -60 score = 6.54801 sequence = ACTAGACTAGCAAGTCTAGT Site: position = -88 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Gene: Shewana3_1296: RND family efflux transporter MFP subunit	* Shewanella sp MR-4 Site: position = -59 score = 6.54801 sequence = ACTAGACTAGCAAGTCTAGT Site: position = -87 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Gene: Shewmr4_1246: RND family efflux transporter MFP subunit	* Shewanella sp MR-7 Site: position = -60 score = 6.54801 sequence = ACTAGACTAGCAAGTCTAGT Site: position = -88 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Gene: Shewmr7_1316: RND family efflux transporter MFP subunit	* Shewanella baltica OS155 Site: position = -61 score = 6.54801 sequence = ACTAGACTAGCAAGTCTAGT Site: position = -89 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Gene: Sbal_2973: RND family efflux transporter MFP subunit	* Shewanella denitrificans OS217 Site: position = -106 score = 5.97543 sequence = AATAGACTTGGTAGTCTAGT Site: position = -134 score = 6.83763 sequence = AATAGACTGGACAGTCTAGT Gene: Sden_1278: RND family efflux transporter MFP subunit	* Shewanella frigidimarina NCIMB 400 Site: position = -137 score = 5.50711 sequence = ACTAGACTACTGAGTCTAGT Site: position = -165 score = 6.83763 sequence = AATAGACTGGACAGTCTAGT Gene: Sfri_1148: RND family efflux transporter MFP subunit	* Shewanella amazonensis SB2B Site: position = -101 score = 6.41938 sequence = AATAGACTAGACAGTCCAGT Site: position = -73 score = 6.41938 sequence = AATAGACTAGACAGTCCAGT Gene: Sama_2342: RND family efflux transporter MFP subunit	* Shewanella loihica PV-4 Site: position = -64 score = 5.61454 sequence = ATTAGACTAACAAGTCTAGT Site: position = -92 score = 6.54321 sequence = ACTAGACTAGACAGTCCAGT Gene: Shew_1312: RND family efflux transporter MFP subunit	* Shewanella pealeana ATCC 700345 Site: position = -76 score = 6.00463 sequence = ACTAGACTAGACAGTCCAGC Site: position = -104 score = 6.96145 sequence = ACTAGACTGGACAGTCTAGT Gene: Spea_1325: RND family efflux transporter MFP subunit	* Shewanella halifaxensis HAW-EB4 Site: position = -105 score = 6.53211 sequence = AATGGACTGGACAGTCTAGT Site: position = -77 score = 6.42949 sequence = ACTAGACTAGGCAGTCTAGT Gene: Shal_1388: RND family efflux transporter MFP subunit	* Shewanella piezotolerans WP3 Site: position = -77 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Site: position = -105 score = 6.53211 sequence = AATGGACTGGACAGTCTAGT Gene: swp_1475: RND family efflux transporter MFP subunit	* Shewanella sediminis HAW-EB3 Site: position = -65 score = 6.30567 sequence = AATAGACTAGGCAGTCTAGT Site: position = -93 score = 6.96145 sequence = ACTAGACTGGACAGTCTAGT Gene: Ssed_3112: RND family efflux transporter MFP subunit	* Shewanella woodyi ATCC 51908 Site: position = -64 score = 6.7249 sequence = AATAGACTAGACAGTCTAGT Site: position = -92 score = 6.96145 sequence = ACTAGACTGGACAGTCTAGT Gene: Swoo_1570: RND family efflux transporter MFP subunit	RND family efflux transporter MFP subunit
SO3279	Shewanella oneidensis MR-1 Gene: SO_3279: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella putrefaciens CN-32 Gene: Sputcn32_2636: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella sp W3-18-1 Gene: Sputw3181_1371: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella sp ANA-3 Gene: Shewana3_1295: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella sp MR-4 Gene: Shewmr4_1245: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella sp MR-7 Gene: Shewmr7_1315: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella baltica OS155 Gene: Sbal_2974: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella denitrificans OS217 Gene: Sden_1277: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella frigidimarina NCIMB 400 Gene: Sfri_1147: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella amazonensis SB2B Gene: Sama_2343: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella loihica PV-4 Gene: Shew_1311: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella pealeana ATCC 700345 Gene: Spea_1324: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella halifaxensis HAW-EB4 Gene: Shal_1387: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella piezotolerans WP3 Gene: swp_1474: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella sediminis HAW-EB3 Gene: Ssed_3113: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	Shewanella woodyi ATCC 51908 Gene: Swoo_1569: acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family	acriflavine/multidrug efflux protein, AcrB/AcrD/AcrF family

CRON 2.
SO3277	* Shewanella oneidensis MR-1 Site: position = -122 score = 6.11387 sequence = ACTGGACTGTCTAGTCCATT Site: position = -150 score = 6.54801 sequence = ACTAGACTTGCTAGTCTAGT Gene: SO_3277: Transcriptional regulator, TetR family	* Shewanella putrefaciens CN-32 Site: position = -98 score = 5.56067 sequence = ACTAGACTTGTTAGTCTAGA Site: position = -70 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Sputcn32_2634: Transcriptional regulator, TetR family	* Shewanella sp W3-18-1 Site: position = -98 score = 5.56067 sequence = ACTAGACTTGTTAGTCTAGA Site: position = -70 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Sputw3181_1373: Transcriptional regulator, TetR family	* Shewanella sp ANA-3 Site: position = -97 score = 6.54801 sequence = ACTAGACTTGCTAGTCTAGT Site: position = -69 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Shewana3_1297: Transcriptional regulator, TetR family	* Shewanella sp MR-4 Site: position = -97 score = 6.54801 sequence = ACTAGACTTGCTAGTCTAGT Site: position = -69 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Shewmr4_1247: Transcriptional regulator, TetR family	* Shewanella sp MR-7 Site: position = -97 score = 6.54801 sequence = ACTAGACTTGCTAGTCTAGT Site: position = -69 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Shewmr7_1317: Transcriptional regulator, TetR family	* Shewanella baltica OS155 Site: position = -74 score = 6.54801 sequence = ACTAGACTTGCTAGTCTAGT Site: position = -46 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Sbal_2972: Transcriptional regulator, TetR family	* Shewanella denitrificans OS217 Site: position = -95 score = 6.83763 sequence = ACTAGACTGTCCAGTCTATT Site: position = -123 score = 5.97543 sequence = ACTAGACTACCAAGTCTATT Gene: Sden_1279: Transcriptional regulator, TetR family	* Shewanella frigidimarina NCIMB 400 Site: position = -97 score = 5.50711 sequence = ACTAGACTCAGTAGTCTAGT Site: position = -69 score = 6.83763 sequence = ACTAGACTGTCCAGTCTATT Gene: Sfri_1149: Transcriptional regulator, TetR family	* Shewanella amazonensis SB2B Site: position = -100 score = 6.41938 sequence = ACTGGACTGTCTAGTCTATT Site: position = -72 score = 6.41938 sequence = ACTGGACTGTCTAGTCTATT Gene: Sama_2341: Transcriptional regulator, TetR family	* Shewanella loihica PV-4 Site: position = -70 score = 6.54321 sequence = ACTGGACTGTCTAGTCTAGT Site: position = -98 score = 5.61454 sequence = ACTAGACTTGTTAGTCTAAT Gene: Shew_1313: Transcriptional regulator, TetR family	* Shewanella pealeana ATCC 700345 Site: position = -102 score = 6.96145 sequence = ACTAGACTGTCCAGTCTAGT Site: position = -130 score = 6.00463 sequence = GCTGGACTGTCTAGTCTAGT Gene: Spea_1326: Transcriptional regulator, TetR family	* Shewanella halifaxensis HAW-EB4 Site: position = -109 score = 6.53211 sequence = ACTAGACTGTCCAGTCCATT Site: position = -137 score = 6.42949 sequence = ACTAGACTGCCTAGTCTAGT Gene: Shal_1389: Transcriptional regulator, TetR family	* Shewanella piezotolerans WP3 Site: position = -100 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Site: position = -72 score = 6.53211 sequence = ACTAGACTGTCCAGTCCATT Gene: swp_1476: Transcriptional regulator, TetR family	* Shewanella sediminis HAW-EB3 Site: position = -100 score = 6.30567 sequence = ACTAGACTGCCTAGTCTATT Site: position = -72 score = 6.96145 sequence = ACTAGACTGTCCAGTCTAGT Gene: Ssed_3111: Transcriptional regulator, TetR family	* Shewanella woodyi ATCC 51908 Site: position = -75 score = 6.96145 sequence = ACTAGACTGTCCAGTCTAGT Site: position = -103 score = 6.7249 sequence = ACTAGACTGTCTAGTCTATT Gene: Swoo_1571: Transcriptional regulator, TetR family	Transcriptional regulator, TetR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog SO3277 - Shewanellaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --