Regulon of MlnR in Bordetella petrii DSM 12804

Properties
Regulator type:	Transcription factor
TF locus tag:	Bpet3277
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Alcaligenaceae
Statistics of regulated genes:
- Genes	10
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Alcaligenaceae
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.4 Sequence: TTTCCTATAATTATGAATTA Locus tag: Bpet3277 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: Bpet3276 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: Bpet3275 Name: BB3360 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase Locus tag: Bpet3274 Name: matB Funciton: Malonyl CoA synthetase Locus tag: Bpet3273 Name: matP Funciton: TRAP-type malonate transport system, periplasmic component Locus tag: Bpet3272 Name: matM Funciton: TRAP-type malonate transport system, small permease component Locus tag: Bpet3271 Name: matQ Funciton: TRAP-type malonate transport system, large permease component Locus tag: Bpet3270 Name: BAV2471 Funciton: ABC transporter substrate-binding protein Locus tag: Bpet3269 Name: BAV2470 Funciton: ABC transporter, permease protein Locus tag: Bpet3268 Name: BAV2469 Funciton: ABC transporter, ATP-binding protein
	Bpet3277	mlnR	Transcriptional regulator of malonate metabolism, GntR family
	Bpet3276	matA	Malonyl-CoA decarboxylase
	Bpet3275	BB3360	methylmalonyl CoA decarboxylase/enoyl-CoA hydratase
	Bpet3274	matB	Malonyl CoA synthetase
	Bpet3273	matP	TRAP-type malonate transport system, periplasmic component
	Bpet3272	matM	TRAP-type malonate transport system, small permease component
	Bpet3271	matQ	TRAP-type malonate transport system, large permease component
	Bpet3270	BAV2471	ABC transporter substrate-binding protein
	Bpet3269	BAV2470	ABC transporter, permease protein
	Bpet3268	BAV2469	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD