Profile of regulator MlnR in Alcaligenaceae
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Malonate metabolism |
| Effector: | |
| Regulog: | MlnR - Alcaligenaceae |
Member of regulog collections
- By taxonomy - Alcaligenaceae
- By TF family - GntR/Others
- By pathway - Malonate metabolism
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bordetella bronchiseptica RB50 | |||||
| BB3362 | mlnR | -37 | 6.7 | TTATTCATAATTATGAATTA | |
| Bordetella petrii DSM 12804 | |||||
| Bpet3277 | mlnR | -43 | 5.4 | TTTCCTATAATTATGAATTA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |