Regulon of MlnR in Bordetella bronchiseptica RB50

Properties
Regulator type:	Transcription factor
TF locus tag:	BB3362
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Malonate metabolism
Effector:
Regulog:	MlnR - Alcaligenaceae
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Alcaligenaceae
By TF family - GntR/Others
By pathway - Malonate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.7 Sequence: TTATTCATAATTATGAATTA Locus tag: BB3362 Name: mlnR Funciton: Transcriptional regulator of malonate metabolism, GntR family Locus tag: BB3361 Name: matA Funciton: Malonyl-CoA decarboxylase Locus tag: BB3360 Name: BB3360 Funciton: methylmalonyl CoA decarboxylase/enoyl-CoA hydratase Locus tag: BB3359 Name: matB Funciton: Malonyl CoA synthetase Locus tag: BB3358 Name: null Funciton: putative exported protein Locus tag: BB3357 Name: sodC Funciton: Superoxide dismutase [Cu-Zn] precursor (EC 1.15.1.1) Locus tag: BB3356 Name: BAV2471 Funciton: ABC transporter substrate-binding protein Locus tag: BB3355 Name: BAV2470 Funciton: ABC transporter, permease protein Locus tag: BB3354 Name: BAV2469 Funciton: ABC transporter, ATP-binding protein
	BB3362	mlnR	Transcriptional regulator of malonate metabolism, GntR family
	BB3361	matA	Malonyl-CoA decarboxylase
	BB3360	BB3360	methylmalonyl CoA decarboxylase/enoyl-CoA hydratase
	BB3359	matB	Malonyl CoA synthetase
	BB3358		putative exported protein
	BB3357	sodC	Superoxide dismutase [Cu-Zn] precursor (EC 1.15.1.1)
	BB3356	BAV2471	ABC transporter substrate-binding protein
	BB3355	BAV2470	ABC transporter, permease protein
	BB3354	BAV2469	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD