Regulon of GcvR in Pseudomonas putida KT2440

Properties
Regulator type:	Transcription factor
TF locus tag:	PP0997
Regulator family:	TyrR
Regulation mode:	activator
Biological process:	Glycine metabolism
Effector:	Glycine
Regulog:	GcvR - Pseudomonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - TyrR
By effector - Glycine
By pathway - Glycine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -266 Score: 5.2 Sequence: ATGTATCGTTTTCGCTACGT Position: -247 Score: 5.4 Sequence: TCGTAGCGAAAACGATACAC Position: -166 Score: 5.7 Sequence: CTGTAACGATATCATTCCAC Locus tag: PP0989 Name: gcvH Funciton: Glycine cleavage system H protein Locus tag: PP0988 Name: gcvP Funciton: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2) Locus tag: PP0987 Name: sdaA Funciton: L-serine dehydratase (EC 4.3.1.17) Locus tag: PP0986 Name: gcvT Funciton: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
	PP0989	gcvH	Glycine cleavage system H protein
	PP0988	gcvP	Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
	PP0987	sdaA	L-serine dehydratase (EC 4.3.1.17)
	PP0986	gcvT	Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD