Regulon of GcvR in Pseudomonas mendocina ymp

Properties
Regulator type:	Transcription factor
TF locus tag:	Pmen_1348
Regulator family:	TyrR
Regulation mode:	activator
Biological process:	Glycine metabolism
Effector:	Glycine
Regulog:	GcvR - Pseudomonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - TyrR
By effector - Glycine
By pathway - Glycine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -258 Score: 5.8 Sequence: CTGTATCGATATCGATCCAC Position: -239 Score: 4.7 Sequence: CCGTAACGATTTAGCAACAA Position: -158 Score: 5.7 Sequence: TCGTATCGATATCGTTCCAG Locus tag: Pmen_1346 Name: gcvH Funciton: Glycine cleavage system H protein Locus tag: Pmen_1345 Name: gcvP Funciton: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2) Locus tag: Pmen_1344 Name: glyA Funciton: Serine hydroxymethyltransferase (EC 2.1.2.1) Locus tag: Pmen_1343 Name: gcvT Funciton: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
	Pmen_1346	gcvH	Glycine cleavage system H protein
	Pmen_1345	gcvP	Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
	Pmen_1344	glyA	Serine hydroxymethyltransferase (EC 2.1.2.1)
	Pmen_1343	gcvT	Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD