Regulon of GcvR in Pseudomonas fluorescens Pf-5

Properties
Regulator type:	Transcription factor
TF locus tag:	PFL_4639
Regulator family:	TyrR
Regulation mode:	activator
Biological process:	Glycine metabolism
Effector:	Glycine
Regulog:	GcvR - Pseudomonadales
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 20 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - TyrR
By effector - Glycine
By pathway - Glycine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -280 Score: 5 Sequence: CTGTACTGAAAGCGCTACAG Position: -261 Score: 5.7 Sequence: GTGGAACGATTTCGCTACAA Position: -180 Score: 5.5 Sequence: CTGTAGCGTTTTCGCTACGG Locus tag: PFL_4640 Name: gcvH Funciton: Glycine cleavage system H protein Locus tag: PFL_4641 Name: gcvP Funciton: Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2) Locus tag: PFL_4642 Name: sdaA Funciton: L-serine dehydratase (EC 4.3.1.17) Locus tag: PFL_4643 Name: gcvT Funciton: Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)
	PFL_4640	gcvH	Glycine cleavage system H protein
	PFL_4641	gcvP	Glycine dehydrogenase [decarboxylating] (glycine cleavage system P protein) (EC 1.4.4.2)
	PFL_4642	sdaA	L-serine dehydratase (EC 4.3.1.17)
	PFL_4643	gcvT	Aminomethyltransferase (glycine cleavage system T protein) (EC 2.1.2.10)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD