Regulon of CJA_0601 in Cellvibrio japonicus Ueda107

Properties
Regulator type:	Transcription factor
TF locus tag:	CJA_0601
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Hypothetical ABC transporter
Effector:
Regulog:	CJA_0601 - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	7
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 6.1 Sequence: TGTGTATTAGTGTATTGATACACG Locus tag: CJA_0598 Name: HCH_01828 Funciton: GumN family protein Locus tag: CJA_0599 Name: null Funciton: ABC transporter, ATP-binding protein Locus tag: CJA_0600 Name: CJA_0600 Funciton: putative membrane protein Locus tag: CJA_0601 Name: CJA_0601 Funciton: Transcriptional regulator, GntR family Locus tag: CJA_0602 Name: PF0561 Funciton: Hydrolase, alpha/beta hydrolase fold family Locus tag: CJA_0603 Name: COG4555 Funciton: Putative ABC-type Na+ transport system, ATPase component Locus tag: CJA_0604 Name: COG1668 Funciton: Predicted ABC-type Na+ efflux pump, permease component
	CJA_0598	HCH_01828	GumN family protein
	CJA_0599		ABC transporter, ATP-binding protein
	CJA_0600	CJA_0600	putative membrane protein
	CJA_0601	CJA_0601	Transcriptional regulator, GntR family
	CJA_0602	PF0561	Hydrolase, alpha/beta hydrolase fold family
	CJA_0603	COG4555	Putative ABC-type Na+ transport system, ATPase component
	CJA_0604	COG1668	Predicted ABC-type Na+ efflux pump, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD