Regulog CJA_0601 - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Hypothetical ABC transporter
Effector:
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - GntR/Others
By pathway - Hypothetical ABC transporter

Statistics of regulated genes
Genome	Genes	Operons
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043
Hahella chejuensis KCTC 2396
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297
Marinobacter sp. ELB17
Marinobacter aqueolei
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107	7	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
HCH_01828	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396 Gene: HCH_01828: GumN family protein	Marinomonas sp. MWYL1 Gene: Mmwyl1_1567: GumN family protein	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_13753: GumN family protein	Reinekea sp. MED297 Gene: MED297_06019: GumN family protein	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40 Gene: Sde_0615: GumN family protein	Teredinibacter turnerae T7901 Gene: TERTU_4341: GumN family protein	* Cellvibrio japonicus Ueda107 Site: position = -61 score = 6.05194 sequence = TGTGTATTAGTGTATTGATACACG Gene: CJA_0598: GumN family protein	GumN family protein
CJA_0599	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_0599: ABC transporter, ATP-binding protein	ABC transporter, ATP-binding protein
CJA_0600	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_0600: putative membrane protein	putative membrane protein
CJA_0601	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107 Gene: CJA_0601: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
PF0561	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_3183: Hydrolase, alpha/beta hydrolase fold family	Cellvibrio japonicus Ueda107 Gene: CJA_0602: Hydrolase, alpha/beta hydrolase fold family	Hydrolase, alpha/beta hydrolase fold family
COG4555	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40 Gene: Sde_3736: Putative ABC-type Na+ transport system, ATPase component	Teredinibacter turnerae T7901 Gene: TERTU_3182: Putative ABC-type Na+ transport system, ATPase component	Cellvibrio japonicus Ueda107 Gene: CJA_0603: Putative ABC-type Na+ transport system, ATPase component	Putative ABC-type Na+ transport system, ATPase component
COG1668	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Marinobacter sp. ELB17	Marinobacter aqueolei	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901 Gene: TERTU_3181: Predicted ABC-type Na+ efflux pump, permease component	Cellvibrio japonicus Ueda107 Gene: CJA_0604: Predicted ABC-type Na+ efflux pump, permease component	Predicted ABC-type Na+ efflux pump, permease component

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CJA_0601 - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --