Regulog CJA_0601 - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
| Genome | Genes | Operons |
|---|---|---|
| Alcanivorax borkumensis SK2 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Hahella chejuensis KCTC 2396 | ||
| Marinomonas sp. MWYL1 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Reinekea sp. MED297 | ||
| Marinobacter sp. ELB17 | ||
| Marinobacter aqueolei | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | 7 | 1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| HCH_01828 |
|
|
Gene: HCH_01828: GumN family protein |
Gene: Mmwyl1_1567: GumN family protein |
|
Gene: MED92_13753: GumN family protein |
Gene: MED297_06019: GumN family protein |
|
|
Gene: Sde_0615: GumN family protein |
Gene: TERTU_4341: GumN family protein |
*
Cellvibrio japonicus Ueda107 Site: position = -61 score = 6.05194 sequence = TGTGTATTAGTGTATTGATACACG Gene: CJA_0598: GumN family protein |
GumN family protein |
| CJA_0599 |
|
|
|
|
|
|
|
|
|
|
|
Gene: CJA_0599: ABC transporter, ATP-binding protein |
ABC transporter, ATP-binding protein |
| CJA_0600 |
|
|
|
|
|
|
|
|
|
|
|
Gene: CJA_0600: putative membrane protein |
putative membrane protein |
| CJA_0601 |
|
|
|
|
|
|
|
|
|
|
|
Gene: CJA_0601: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| PF0561 |
|
|
|
|
|
|
|
|
|
|
Gene: TERTU_3183: Hydrolase, alpha/beta hydrolase fold family |
Gene: CJA_0602: Hydrolase, alpha/beta hydrolase fold family |
Hydrolase, alpha/beta hydrolase fold family |
| COG4555 |
|
|
|
|
|
|
|
|
|
Gene: Sde_3736: Putative ABC-type Na+ transport system, ATPase component |
Gene: TERTU_3182: Putative ABC-type Na+ transport system, ATPase component |
Gene: CJA_0603: Putative ABC-type Na+ transport system, ATPase component |
Putative ABC-type Na+ transport system, ATPase component |
| COG1668 |
|
|
|
|
|
|
|
|
|
|
Gene: TERTU_3181: Predicted ABC-type Na+ efflux pump, permease component |
Gene: CJA_0604: Predicted ABC-type Na+ efflux pump, permease component |
Predicted ABC-type Na+ efflux pump, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |