Profile of regulator CJA_0601 in Oceanospirillales/Alteromonadales
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Hypothetical ABC transporter |
| Effector: | |
| Regulog: | CJA_0601 - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - GntR/Others
- By pathway - Hypothetical ABC transporter
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Cellvibrio japonicus Ueda107 | |||||
| CJA_0598 | HCH_01828 | -61 | 6.1 | TGTGTATTAGTGTATTGATACACG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |