Regulon of PsrA in Shewanella piezotolerans WP3

Properties
Regulator type:	Transcription factor
TF locus tag:	swp_2385
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Shewanellaceae
Statistics of regulated genes:
- Genes	24
- Operons	17
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 295 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -175 Score: 5.9 Sequence: ATTAAAACGTGTGTTTAATT Locus tag: swp_0761 Name: SO0881 Funciton: conserved hypothetical protein Locus tag: swp_0762 Name: SO0882 Funciton: oxidoreductase, GMC family
	swp_0761	SO0881	conserved hypothetical protein
	swp_0762	SO0882	oxidoreductase, GMC family
Position: -86 Score: 5.1 Sequence: AATTAATCGTTTGTTTAAAA Position: -73 Score: 5 Sequence: TTTAAAACAGCTGTTTACCA Locus tag: swp_1930 Name: SO2935 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
	swp_1930	SO2935	oxidoreductase, short-chain dehydrogenase/reductase family
Position: -76 Score: 5.1 Sequence: ATTAAAACACCCGTTTATAG Locus tag: swp_5010 Name: etfD Funciton: electron-transferring-flavoprotein dehydrogenase
	swp_5010	etfD	electron-transferring-flavoprotein dehydrogenase
Position: -81 Score: 5.6 Sequence: TGTTAAACAGTTGTTTGAAT Locus tag: swp_0735 Name: echH Funciton: enoyl-CoA hydratase/isomerase family protein
	swp_0735	echH	enoyl-CoA hydratase/isomerase family protein
Position: -98 Score: 5.8 Sequence: ATCTAAACAACCGTTTAAAT Locus tag: swp_3422 Name: fadE3 Funciton: acyl-CoA dehydrogenase
	swp_3422	fadE3	acyl-CoA dehydrogenase
Position: -49 Score: 5.8 Sequence: AATCAAACAACCGTTTGAAA Locus tag: swp_0119 Name: SO0080 Funciton: thioesterase superfamily protein
	swp_0119	SO0080	thioesterase superfamily protein
Position: -284 Score: 5.7 Sequence: ATTTAAATAAGCGTTTAAAT Locus tag: swp_2955 Name: sdhC Funciton: succinate dehydrogenase, cytochrome b556 subunit Locus tag: swp_2953 Name: sdhD Funciton: succinate dehydrogenase subunit D Locus tag: swp_2952 Name: sdhA Funciton: succinate dehydrogenase, flavoprotein subunit Locus tag: swp_2950 Name: sdhB Funciton: succinate dehydrogenase, iron-sulfur protein
	swp_2955	sdhC	succinate dehydrogenase, cytochrome b556 subunit
	swp_2953	sdhD	succinate dehydrogenase subunit D
	swp_2952	sdhA	succinate dehydrogenase, flavoprotein subunit
	swp_2950	sdhB	succinate dehydrogenase, iron-sulfur protein
Position: -134 Score: 5.5 Sequence: ATTTAAACGCTTGTATGATT Locus tag: swp_2289 Name: fadD1 Funciton: long-chain-fatty-acid--CoA ligase
	swp_2289	fadD1	long-chain-fatty-acid--CoA ligase
Position: -31 Score: 5.3 Sequence: ATTAAATCACTTGTTTAAAA Position: -18 Score: 5.4 Sequence: TTTAAAAAGGATGTTTGAAT Locus tag: swp_2472 Name: fadH Funciton: NADP-dependent 2,4-dienoyl-CoA reductase
	swp_2472	fadH	NADP-dependent 2,4-dienoyl-CoA reductase
Position: -181 Score: 5.9 Sequence: ATTTAAACATTTGTTTGAAA Locus tag: swp_2312 Name: fadE2 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	swp_2312	fadE2	oxidoreductase, acyl-CoA dehydrogenase family
Position: -154 Score: 5.4 Sequence: AAACAAACAAGTGTTTAAAA Locus tag: swp_3140 Name: fadI Funciton: fatty oxidation complex, beta subunit Locus tag: swp_3139 Name: fadJ Funciton: fatty oxidation complex, alpha subunit
	swp_3140	fadI	fatty oxidation complex, beta subunit
	swp_3139	fadJ	fatty oxidation complex, alpha subunit
Position: -161 Score: 5.5 Sequence: ATTCGAACACTCGTTTAAAT Locus tag: swp_0035 Name: fadB Funciton: fatty oxidation complex, alpha subunit Locus tag: swp_0034 Name: fadA Funciton: fatty oxidation complex, beta subunit
	swp_0035	fadB	fatty oxidation complex, alpha subunit
	swp_0034	fadA	fatty oxidation complex, beta subunit
Position: -101 Score: 5.7 Sequence: ATTTAAACGCTTATTTAAAT Locus tag: swp_2957 Name: gltA Funciton: citrate synthase
	swp_2957	gltA	citrate synthase
Position: -66 Score: 5.7 Sequence: ATCTAAACACCTGTTTGATT Locus tag: swp_3965 Name: fadD2 Funciton: long-chain-fatty-acid--CoA ligase
	swp_3965	fadD2	long-chain-fatty-acid--CoA ligase
Position: -41 Score: 6.2 Sequence: ATTTAAACGAGTGTTTAAAT Locus tag: swp_2385 Name: psrA Funciton: fatty acid degradation transcriptional regulator, TetR family Locus tag: swp_2386 Name: fadE1 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	swp_2385	psrA	fatty acid degradation transcriptional regulator, TetR family
	swp_2386	fadE1	oxidoreductase, acyl-CoA dehydrogenase family
Position: -40 Score: 5.9 Sequence: ATTGAAACATCTGTTTAAAT Locus tag: swp_2502 Name: acdH Funciton: acyl-CoA dehydrogenase family protein
	swp_2502	acdH	acyl-CoA dehydrogenase family protein
Position: -547 Score: 6.1 Sequence: ATTTAAACGACTGTTTAATT Locus tag: swp_1433 Name: aceB Funciton: malate synthase A
	swp_1433	aceB	malate synthase A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Shewanella piezotolerans WP3

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --