Regulon of PsrA in Shewanella loihica PV-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shew_2052
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	17
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 295 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -130 Score: 5.5 Sequence: ATTAAAACGCCCGTATGATT Locus tag: Shew_2188 Name: fadD1 Funciton: long-chain-fatty-acid--CoA ligase
	Shew_2188	fadD1	long-chain-fatty-acid--CoA ligase
Position: -87 Score: 4.4 Sequence: AATCAGTCATTTGTTTTAAA Position: -74 Score: 4.4 Sequence: TTTTAAACATTCGTTTCAGG Locus tag: Shew_2409 Name: SO2935 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
	Shew_2409	SO2935	oxidoreductase, short-chain dehydrogenase/reductase family
Position: -103 Score: 5.8 Sequence: ATTTAAACACTTATTTAAAT Locus tag: Shew_1650 Name: gltA Funciton: citrate synthase
	Shew_1650	gltA	citrate synthase
Position: -47 Score: 5.7 Sequence: AATAAAACACCCGTTTCAAT Locus tag: Shew_0086 Name: etfD Funciton: electron-transferring-flavoprotein dehydrogenase
	Shew_0086	etfD	electron-transferring-flavoprotein dehydrogenase
Position: -80 Score: 5.8 Sequence: AATTAAACGCGTGTTTGAAA Locus tag: Shew_0540 Name: echH Funciton: enoyl-CoA hydratase/isomerase family protein
	Shew_0540	echH	enoyl-CoA hydratase/isomerase family protein
Position: -199 Score: 4.9 Sequence: ATTCAAACAATTATATGAAA Position: -186 Score: 5.5 Sequence: TATGAAACAAGTGTTTAAAT Locus tag: Shew_3003 Name: fadE3 Funciton: acyl-CoA dehydrogenase
	Shew_3003	fadE3	acyl-CoA dehydrogenase
Position: -329 Score: 5.8 Sequence: ATTTAAATAAGTGTTTAAAT Locus tag: Shew_1651 Name: sdhC Funciton: succinate dehydrogenase, cytochrome b556 subunit Locus tag: Shew_1652 Name: sdhD Funciton: succinate dehydrogenase subunit D Locus tag: Shew_1653 Name: sdhA Funciton: succinate dehydrogenase, flavoprotein subunit Locus tag: Shew_1654 Name: sdhB Funciton: succinate dehydrogenase, iron-sulfur protein
	Shew_1651	sdhC	succinate dehydrogenase, cytochrome b556 subunit
	Shew_1652	sdhD	succinate dehydrogenase subunit D
	Shew_1653	sdhA	succinate dehydrogenase, flavoprotein subunit
	Shew_1654	sdhB	succinate dehydrogenase, iron-sulfur protein
Position: -41 Score: 6.1 Sequence: ATTAAAACGACTGTTTTAAT Locus tag: Shew_1961 Name: acdH Funciton: acyl-CoA dehydrogenase family protein
	Shew_1961	acdH	acyl-CoA dehydrogenase family protein
Position: -35 Score: 5.4 Sequence: AACTAAACACTTGTTTGAAA Locus tag: Shew_3772 Name: SO0080 Funciton: thioesterase superfamily protein
	Shew_3772	SO0080	thioesterase superfamily protein
Position: -166 Score: 5.4 Sequence: AACCAAACAGGTGTTTAAAA Locus tag: Shew_2426 Name: fadI Funciton: fatty oxidation complex, beta subunit Locus tag: Shew_2425 Name: fadJ Funciton: fatty oxidation complex, alpha subunit
	Shew_2426	fadI	fatty oxidation complex, beta subunit
	Shew_2425	fadJ	fatty oxidation complex, alpha subunit
Position: -155 Score: 5.5 Sequence: AGTTAAACAATTGTTTGAAA Locus tag: Shew_2108 Name: fadE2 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Shew_2108	fadE2	oxidoreductase, acyl-CoA dehydrogenase family
Position: -116 Score: 6 Sequence: ATTAAAACATGTGTTTAATT Locus tag: Shew_0590 Name: SO0881 Funciton: conserved hypothetical protein Locus tag: Shew_0591 Name: SO0882 Funciton: oxidoreductase, GMC family
	Shew_0590	SO0881	conserved hypothetical protein
	Shew_0591	SO0882	oxidoreductase, GMC family
Position: -31 Score: 5 Sequence: TTTAAATCACTTGTTTAAAA Position: -18 Score: 5.4 Sequence: TTTAAAAAGGATGTTTAAAT Locus tag: Shew_1942 Name: fadH Funciton: NADP-dependent 2,4-dienoyl-CoA reductase
	Shew_1942	fadH	NADP-dependent 2,4-dienoyl-CoA reductase
Position: -130 Score: 5.3 Sequence: TGTTAAACGATTGTTTTATT Position: -70 Score: 5.1 Sequence: GTCTAAACACCTGTTTGATT Locus tag: Shew_3084 Name: fadD2 Funciton: long-chain-fatty-acid--CoA ligase
	Shew_3084	fadD2	long-chain-fatty-acid--CoA ligase
Position: -39 Score: 6.2 Sequence: ATTTAAACACACGTTTAAAT Locus tag: Shew_2052 Name: psrA Funciton: fatty acid degradation transcriptional regulator, TetR family Locus tag: Shew_2051 Name: fadE1 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Shew_2052	psrA	fatty acid degradation transcriptional regulator, TetR family
	Shew_2051	fadE1	oxidoreductase, acyl-CoA dehydrogenase family
Position: -161 Score: 6.1 Sequence: AATTAAACAAGTGTTTAAAT Locus tag: Shew_0019 Name: fadB Funciton: fatty oxidation complex, alpha subunit Locus tag: Shew_0018 Name: fadA Funciton: fatty oxidation complex, beta subunit
	Shew_0019	fadB	fatty oxidation complex, alpha subunit
	Shew_0018	fadA	fatty oxidation complex, beta subunit
Position: -527 Score: 5.9 Sequence: ATTAAAACGCGCGTTTGATT Locus tag: Shew_1275 Name: aceB Funciton: malate synthase A Locus tag: Shew_1276 Name: aceA Funciton: isocitrate lyase
	Shew_1275	aceB	malate synthase A
	Shew_1276	aceA	isocitrate lyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Shewanella loihica PV-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --