Regulon of PsrA in Shewanella amazonensis SB2B

Properties
Regulator type:	Transcription factor
TF locus tag:	Sama_1816
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Shewanellaceae
Statistics of regulated genes:
- Genes	23
- Operons	15
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 295 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -77 Score: 6 Sequence: AATTAAACATGTGTTTGAAT Locus tag: Sama_3052 Name: echH Funciton: enoyl-CoA hydratase/isomerase family protein
	Sama_3052	echH	enoyl-CoA hydratase/isomerase family protein
Position: -21 Score: 5.4 Sequence: TGTTAAACAATCGTTTGAAT Locus tag: Sama_0073 Name: SO0080 Funciton: thioesterase superfamily protein
	Sama_0073	SO0080	thioesterase superfamily protein
Position: -327 Score: 5.7 Sequence: ATTTAAATAAGCGTTTAAAT Locus tag: Sama_1423 Name: sdhC Funciton: succinate dehydrogenase, cytochrome b556 subunit Locus tag: Sama_1424 Name: sdhD Funciton: succinate dehydrogenase subunit D Locus tag: Sama_1425 Name: sdhA Funciton: succinate dehydrogenase, flavoprotein subunit Locus tag: Sama_1426 Name: sdhB Funciton: succinate dehydrogenase, iron-sulfur protein
	Sama_1423	sdhC	succinate dehydrogenase, cytochrome b556 subunit
	Sama_1424	sdhD	succinate dehydrogenase subunit D
	Sama_1425	sdhA	succinate dehydrogenase, flavoprotein subunit
	Sama_1426	sdhB	succinate dehydrogenase, iron-sulfur protein
Position: -73 Score: 5.1 Sequence: TTTTAAACAGCTGTATGACT Locus tag: Sama_2121 Name: SO2935 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
	Sama_2121	SO2935	oxidoreductase, short-chain dehydrogenase/reductase family
Position: -151 Score: 5.7 Sequence: AATAAAACGTATGTTTAATT Locus tag: Sama_2999 Name: SO0881 Funciton: conserved hypothetical protein Locus tag: Sama_2998 Name: SO0882 Funciton: oxidoreductase, GMC family
	Sama_2999	SO0881	conserved hypothetical protein
	Sama_2998	SO0882	oxidoreductase, GMC family
Position: -149 Score: 5.9 Sequence: ATTTAAACATTTGTTTGAAA Locus tag: Sama_1870 Name: fadE2 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Sama_1870	fadE2	oxidoreductase, acyl-CoA dehydrogenase family
Position: -144 Score: 5.6 Sequence: ATGCAAACAAGTGTTTAAAA Locus tag: Sama_2168 Name: fadI Funciton: fatty oxidation complex, beta subunit Locus tag: Sama_2167 Name: fadJ Funciton: fatty oxidation complex, alpha subunit
	Sama_2168	fadI	fatty oxidation complex, beta subunit
	Sama_2167	fadJ	fatty oxidation complex, alpha subunit
Position: -145 Score: 5.9 Sequence: AATTAAACGATCGTTTTAAT Locus tag: Sama_0032 Name: fadB Funciton: fatty oxidation complex, alpha subunit Locus tag: Sama_0031 Name: fadA Funciton: fatty oxidation complex, beta subunit
	Sama_0032	fadB	fatty oxidation complex, alpha subunit
	Sama_0031	fadA	fatty oxidation complex, beta subunit
Position: -40 Score: 5.9 Sequence: ATTGAAACAACTGTTTAAAT Locus tag: Sama_1743 Name: acdH Funciton: acyl-CoA dehydrogenase family protein
	Sama_1743	acdH	acyl-CoA dehydrogenase family protein
Position: -18 Score: 5.5 Sequence: TTTTAAAAGGGTGTTTGAAT Locus tag: Sama_1724 Name: fadH Funciton: NADP-dependent 2,4-dienoyl-CoA reductase
	Sama_1724	fadH	NADP-dependent 2,4-dienoyl-CoA reductase
Position: -499 Score: 5.9 Sequence: ATTAAAACGTGCGTTTAATT Locus tag: Sama_2381 Name: aceB Funciton: malate synthase A Locus tag: Sama_2380 Name: aceA Funciton: isocitrate lyase
	Sama_2381	aceB	malate synthase A
	Sama_2380	aceA	isocitrate lyase
Position: -120 Score: 5.6 Sequence: ATTTAAACGCCCGTATGATT Locus tag: Sama_1934 Name: fadD1 Funciton: long-chain-fatty-acid--CoA ligase
	Sama_1934	fadD1	long-chain-fatty-acid--CoA ligase
Position: -51 Score: 5.4 Sequence: TATAAAACACCCGTTTACAT Locus tag: Sama_3523 Name: etfD Funciton: electron-transferring-flavoprotein dehydrogenase
	Sama_3523	etfD	electron-transferring-flavoprotein dehydrogenase
Position: -105 Score: 5.7 Sequence: ATTTAAACGCTTATTTAAAT Locus tag: Sama_1422 Name: gltA Funciton: citrate synthase
	Sama_1422	gltA	citrate synthase
Position: 7 Score: 5.9 Sequence: ATTTAAACGAGTGTTTTAAA Locus tag: Sama_1816 Name: psrA Funciton: fatty acid degradation transcriptional regulator, TetR family Locus tag: Sama_1815 Name: fadE1 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Sama_1816	psrA	fatty acid degradation transcriptional regulator, TetR family
	Sama_1815	fadE1	oxidoreductase, acyl-CoA dehydrogenase family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Shewanella amazonensis SB2B

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --