Regulon of PsrA in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_2116
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Shewanellaceae
Statistics of regulated genes:
- Genes	23
- Operons	15
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 295 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -24 Score: 6 Sequence: ATTTAAACAGGTGTTTTAAA Locus tag: Sden_2116 Name: psrA Funciton: fatty acid degradation transcriptional regulator, TetR family Locus tag: Sden_2115 Name: fadE1 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Sden_2116	psrA	fatty acid degradation transcriptional regulator, TetR family
	Sden_2115	fadE1	oxidoreductase, acyl-CoA dehydrogenase family
Position: -150 Score: 5.7 Sequence: TTTTAAACAATTGTTTGAAA Locus tag: Sden_1764 Name: fadE2 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Sden_1764	fadE2	oxidoreductase, acyl-CoA dehydrogenase family
Position: -46 Score: 5.5 Sequence: ATTCAAGCGAGCGTTTGAAT Locus tag: Sden_0953 Name: Sbal_0657 Funciton: hypothetical protein
	Sden_0953	Sbal_0657	hypothetical protein
Position: -20 Score: 5.3 Sequence: TACCAAACGAGCGTTTAAAT Locus tag: Sden_0074 Name: SO0080 Funciton: thioesterase superfamily protein
	Sden_0074	SO0080	thioesterase superfamily protein
Position: -39 Score: 6.1 Sequence: ATTAAAACACATGTTTGAAT Locus tag: Sden_1761 Name: acdH Funciton: acyl-CoA dehydrogenase family protein
	Sden_1761	acdH	acyl-CoA dehydrogenase family protein
Position: -81 Score: 6.1 Sequence: AATTAAACAGATGTTTGAAT Locus tag: Sden_3229 Name: echH Funciton: enoyl-CoA hydratase/isomerase family protein
	Sden_3229	echH	enoyl-CoA hydratase/isomerase family protein
Position: -374 Score: 5.6 Sequence: ATTTAAATAAGCGTTTAATT Locus tag: Sden_2187 Name: sdhC Funciton: succinate dehydrogenase, cytochrome b556 subunit Locus tag: Sden_2186 Name: sdhD Funciton: succinate dehydrogenase subunit D Locus tag: Sden_2185 Name: sdhA Funciton: succinate dehydrogenase, flavoprotein subunit Locus tag: Sden_2184 Name: sdhB Funciton: succinate dehydrogenase, iron-sulfur protein
	Sden_2187	sdhC	succinate dehydrogenase, cytochrome b556 subunit
	Sden_2186	sdhD	succinate dehydrogenase subunit D
	Sden_2185	sdhA	succinate dehydrogenase, flavoprotein subunit
	Sden_2184	sdhB	succinate dehydrogenase, iron-sulfur protein
Position: -50 Score: 5.6 Sequence: AATTAAACGCTTATTTAAAT Locus tag: Sden_2189 Name: gltA Funciton: citrate synthase
	Sden_2189	gltA	citrate synthase
Position: -120 Score: 5.1 Sequence: ATGCAAACGCTTGTTTAACA Locus tag: Sden_2539 Name: etfB Funciton: electron transfer flavoprotein, beta subunit Locus tag: Sden_2538 Name: etfA Funciton: electron transfer flavoprotein, alpha subunit
	Sden_2539	etfB	electron transfer flavoprotein, beta subunit
	Sden_2538	etfA	electron transfer flavoprotein, alpha subunit
Position: -31 Score: 5 Sequence: TTTAAATCACTTGTTTAAAA Position: -18 Score: 5.4 Sequence: TTTAAAAAGGATGTTTGAAT Locus tag: Sden_1900 Name: fadH Funciton: NADP-dependent 2,4-dienoyl-CoA reductase
	Sden_1900	fadH	NADP-dependent 2,4-dienoyl-CoA reductase
Position: -470 Score: 5.3 Sequence: ATTAAAACGGTCGTTTGATG Locus tag: Sden_1245 Name: aceB Funciton: malate synthase A Locus tag: Sden_1246 Name: aceA Funciton: isocitrate lyase
	Sden_1245	aceB	malate synthase A
	Sden_1246	aceA	isocitrate lyase
Position: -73 Score: 5.3 Sequence: TTTAAAACAATCGTTTACTT Locus tag: Sden_2473 Name: SO2935 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
	Sden_2473	SO2935	oxidoreductase, short-chain dehydrogenase/reductase family
Position: -149 Score: 6.1 Sequence: AATTAAACGGCCGTTTAAAT Locus tag: Sden_0015 Name: fadB Funciton: fatty oxidation complex, alpha subunit Locus tag: Sden_0014 Name: fadA Funciton: fatty oxidation complex, beta subunit
	Sden_0015	fadB	fatty oxidation complex, alpha subunit
	Sden_0014	fadA	fatty oxidation complex, beta subunit
Position: -141 Score: 5.4 Sequence: AAATAAACGGGTGTTTAAAA Locus tag: Sden_1529 Name: fadI Funciton: fatty oxidation complex, beta subunit Locus tag: Sden_1530 Name: fadJ Funciton: fatty oxidation complex, alpha subunit
	Sden_1529	fadI	fatty oxidation complex, beta subunit
	Sden_1530	fadJ	fatty oxidation complex, alpha subunit
Position: -169 Score: 5.6 Sequence: ATTTAAACGGCCGTATGATT Locus tag: Sden_1625 Name: fadD1 Funciton: long-chain-fatty-acid--CoA ligase
	Sden_1625	fadD1	long-chain-fatty-acid--CoA ligase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Shewanella denitrificans OS217

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --