Regulon of PsrA in Shewanella sp MR-4

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr4_2050
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	16
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 295 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 4.5 Sequence: TTTCATTCATTTGTTTGAAA Position: -73 Score: 4.5 Sequence: TTTGAAACATGCGTTTAGCA Locus tag: Shewmr4_1468 Name: SO2935 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
	Shewmr4_1468	SO2935	oxidoreductase, short-chain dehydrogenase/reductase family
Position: -78 Score: 5.9 Sequence: ATTAAAACGTGTGTTTAATT Locus tag: Shewmr4_0737 Name: SO0881 Funciton: conserved hypothetical protein Locus tag: Shewmr4_0738 Name: SO0882 Funciton: oxidoreductase, GMC family
	Shewmr4_0737	SO0881	conserved hypothetical protein
	Shewmr4_0738	SO0882	oxidoreductase, GMC family
Position: -121 Score: 5.2 Sequence: ATGCAAACAGGCGTTTGAGT Locus tag: Shewmr4_1352 Name: etfB Funciton: electron transfer flavoprotein, beta subunit Locus tag: Shewmr4_1353 Name: etfA Funciton: electron transfer flavoprotein, alpha subunit
	Shewmr4_1352	etfB	electron transfer flavoprotein, beta subunit
	Shewmr4_1353	etfA	electron transfer flavoprotein, alpha subunit
Position: -80 Score: 6.1 Sequence: AATTAAACATCTGTTTGAAT Locus tag: Shewmr4_3240 Name: echH Funciton: enoyl-CoA hydratase/isomerase family protein
	Shewmr4_3240	echH	enoyl-CoA hydratase/isomerase family protein
Position: -74 Score: 5.4 Sequence: AATAAAACGCCCGTTTACAA Locus tag: Shewmr4_0272 Name: etfD Funciton: electron-transferring-flavoprotein dehydrogenase
	Shewmr4_0272	etfD	electron-transferring-flavoprotein dehydrogenase
Position: -331 Score: 5.7 Sequence: ATTTAAATAAGCGTTTAAAT Locus tag: Shewmr4_1631 Name: sdhC Funciton: succinate dehydrogenase, cytochrome b556 subunit Locus tag: Shewmr4_1632 Name: sdhD Funciton: succinate dehydrogenase subunit D Locus tag: Shewmr4_1633 Name: sdhA Funciton: succinate dehydrogenase, flavoprotein subunit Locus tag: Shewmr4_1634 Name: sdhB Funciton: succinate dehydrogenase, iron-sulfur protein
	Shewmr4_1631	sdhC	succinate dehydrogenase, cytochrome b556 subunit
	Shewmr4_1632	sdhD	succinate dehydrogenase subunit D
	Shewmr4_1633	sdhA	succinate dehydrogenase, flavoprotein subunit
	Shewmr4_1634	sdhB	succinate dehydrogenase, iron-sulfur protein
Position: -31 Score: 5 Sequence: TTTAAATCACTTGTTTAAAA Position: -18 Score: 5.4 Sequence: TTTAAAAAGGATGTTTGAAT Locus tag: Shewmr4_1910 Name: fadH Funciton: NADP-dependent 2,4-dienoyl-CoA reductase
	Shewmr4_1910	fadH	NADP-dependent 2,4-dienoyl-CoA reductase
Position: -167 Score: 5.4 Sequence: AAACAAACAGGTGTTTAAAA Locus tag: Shewmr4_1407 Name: fadI Funciton: fatty oxidation complex, beta subunit Locus tag: Shewmr4_1408 Name: fadJ Funciton: fatty oxidation complex, alpha subunit
	Shewmr4_1407	fadI	fatty oxidation complex, beta subunit
	Shewmr4_1408	fadJ	fatty oxidation complex, alpha subunit
Position: -105 Score: 5.7 Sequence: ATTTAAACGCTTATTTAAAT Locus tag: Shewmr4_1630 Name: gltA Funciton: citrate synthase
	Shewmr4_1630	gltA	citrate synthase
Position: -62 Score: 5.6 Sequence: ATCTAAACACTCGTTTGATT Locus tag: Shewmr4_0883 Name: fadD2 Funciton: long-chain-fatty-acid--CoA ligase
	Shewmr4_0883	fadD2	long-chain-fatty-acid--CoA ligase
Position: -136 Score: 5.5 Sequence: ATTAAAACGCCCGTATGATT Locus tag: Shewmr4_2177 Name: fadD1 Funciton: long-chain-fatty-acid--CoA ligase
	Shewmr4_2177	fadD1	long-chain-fatty-acid--CoA ligase
Position: -162 Score: 6.1 Sequence: AATTAAACAGTCGTTTAAAT Locus tag: Shewmr4_0018 Name: fadB Funciton: fatty oxidation complex, alpha subunit Locus tag: Shewmr4_0017 Name: fadA Funciton: fatty oxidation complex, beta subunit
	Shewmr4_0018	fadB	fatty oxidation complex, alpha subunit
	Shewmr4_0017	fadA	fatty oxidation complex, beta subunit
Position: -38 Score: 5.9 Sequence: ATTTAAACGAGTGTTTTAAA Locus tag: Shewmr4_2050 Name: psrA Funciton: fatty acid degradation transcriptional regulator, TetR family Locus tag: Shewmr4_2049 Name: fadE1 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Shewmr4_2050	psrA	fatty acid degradation transcriptional regulator, TetR family
	Shewmr4_2049	fadE1	oxidoreductase, acyl-CoA dehydrogenase family
Position: -156 Score: 5.9 Sequence: ATTTAAACAATTGTTTGAAA Locus tag: Shewmr4_2146 Name: fadE2 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	Shewmr4_2146	fadE2	oxidoreductase, acyl-CoA dehydrogenase family
Position: -41 Score: 6.2 Sequence: ATTAAAACAACTGTTTAAAT Locus tag: Shewmr4_1931 Name: acdH Funciton: acyl-CoA dehydrogenase family protein
	Shewmr4_1931	acdH	acyl-CoA dehydrogenase family protein
Position: -507 Score: 5.2 Sequence: AGTTAAACGAGTGTTTAAAC Locus tag: Shewmr4_2767 Name: aceB Funciton: malate synthase A Locus tag: Shewmr4_2766 Name: aceA Funciton: isocitrate lyase
	Shewmr4_2767	aceB	malate synthase A
	Shewmr4_2766	aceA	isocitrate lyase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Shewanella sp MR-4

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --