Regulon of PsrA in Shewanella oneidensis MR-1

Properties
Regulator type:	Transcription factor
TF locus tag:	SO_2493
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Fatty acid degradation
Effector:	Oleate
Regulog:	PsrA - Shewanellaceae
Statistics of regulated genes:
- Genes	25
- Operons	16
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 295 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - PsrA
By TF family - TetR
By effector - Oleate
By pathway - Fatty acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -157 Score: 5.9 Sequence: ATTTAAACAATTGTTTGAAA Locus tag: SO_2536 Name: fadE2 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	SO_2536	fadE2	oxidoreductase, acyl-CoA dehydrogenase family
Position: -86 Score: 4.5 Sequence: TTTCATTCATTTGTTTGAAA Position: -73 Score: 4.5 Sequence: TTTGAAACATGCGTTTAGCA Locus tag: SO_2935 Name: SO2935 Funciton: oxidoreductase, short-chain dehydrogenase/reductase family
	SO_2935	SO2935	oxidoreductase, short-chain dehydrogenase/reductase family
Position: -105 Score: 5.7 Sequence: ATTTAAACGCTTATTTAAAT Locus tag: SO_1926 Name: gltA Funciton: citrate synthase
	SO_1926	gltA	citrate synthase
Position: -70 Score: 5.4 Sequence: AATAAAACGCCCGTTTACAA Locus tag: SO_4453 Name: etfD Funciton: electron-transferring-flavoprotein dehydrogenase
	SO_4453	etfD	electron-transferring-flavoprotein dehydrogenase
Position: -331 Score: 5.7 Sequence: ATTTAAATAAGCGTTTAAAT Locus tag: SO_1927 Name: sdhC Funciton: succinate dehydrogenase, cytochrome b556 subunit Locus tag: SO_1927.1 Name: sdhD Funciton: succinate dehydrogenase subunit D Locus tag: SO_1928 Name: sdhA Funciton: succinate dehydrogenase, flavoprotein subunit Locus tag: SO_1929 Name: sdhB Funciton: succinate dehydrogenase, iron-sulfur protein
	SO_1927	sdhC	succinate dehydrogenase, cytochrome b556 subunit
	SO_1927.1	sdhD	succinate dehydrogenase subunit D
	SO_1928	sdhA	succinate dehydrogenase, flavoprotein subunit
	SO_1929	sdhB	succinate dehydrogenase, iron-sulfur protein
Position: -80 Score: 6.1 Sequence: AATTAAACATCTGTTTGAAT Locus tag: SO_3908 Name: echH Funciton: enoyl-CoA hydratase/isomerase family protein
	SO_3908	echH	enoyl-CoA hydratase/isomerase family protein
Position: -78 Score: 5.9 Sequence: ATTAAAACGTGTGTTTAATT Locus tag: SO_0881 Name: SO0881 Funciton: conserved hypothetical protein Locus tag: SO_0882 Name: SO0882 Funciton: oxidoreductase, GMC family
	SO_0881	SO0881	conserved hypothetical protein
	SO_0882	SO0882	oxidoreductase, GMC family
Position: -121 Score: 5.4 Sequence: ATGCAAACAGGCGTTTGACT Locus tag: SO_3145 Name: etfB Funciton: electron transfer flavoprotein, beta subunit Locus tag: SO_3144 Name: etfA Funciton: electron transfer flavoprotein, alpha subunit
	SO_3145	etfB	electron transfer flavoprotein, beta subunit
	SO_3144	etfA	electron transfer flavoprotein, alpha subunit
Position: -41 Score: 6.1 Sequence: ATTAAAACAACTGTTTTAAT Locus tag: SO_2395 Name: acdH Funciton: acyl-CoA dehydrogenase family protein
	SO_2395	acdH	acyl-CoA dehydrogenase family protein
Position: -163 Score: 5.4 Sequence: AAACAAACAGGTGTTTAAAA Locus tag: SO_3089 Name: fadI Funciton: fatty oxidation complex, beta subunit Locus tag: SO_3088 Name: fadJ Funciton: fatty oxidation complex, alpha subunit
	SO_3089	fadI	fatty oxidation complex, beta subunit
	SO_3088	fadJ	fatty oxidation complex, alpha subunit
Position: -507 Score: 5.6 Sequence: AATGAAACGTATGTTTGAAT Locus tag: SO_1483 Name: aceB Funciton: malate synthase A Locus tag: SO_1484 Name: aceA Funciton: isocitrate lyase
	SO_1483	aceB	malate synthase A
	SO_1484	aceA	isocitrate lyase
Position: -63 Score: 5.6 Sequence: ATCTAAACACCCGTTTGATT Locus tag: SO_3664 Name: fadD2 Funciton: long-chain-fatty-acid--CoA ligase
	SO_3664	fadD2	long-chain-fatty-acid--CoA ligase
Position: 40 Score: 5.9 Sequence: ATTTAAACGAGTGTTTTAAA Locus tag: SO_2493 Name: psrA Funciton: fatty acid degradation transcriptional regulator, TetR family Locus tag: SO_2492 Name: fadE1 Funciton: oxidoreductase, acyl-CoA dehydrogenase family
	SO_2493	psrA	fatty acid degradation transcriptional regulator, TetR family
	SO_2492	fadE1	oxidoreductase, acyl-CoA dehydrogenase family
Position: -162 Score: 6.1 Sequence: AATTAAACAGTCGTTTAAAT Locus tag: SO_0021 Name: fadB Funciton: fatty oxidation complex, alpha subunit Locus tag: SO_0020 Name: fadA Funciton: fatty oxidation complex, beta subunit
	SO_0021	fadB	fatty oxidation complex, alpha subunit
	SO_0020	fadA	fatty oxidation complex, beta subunit
Position: -31 Score: 5 Sequence: TTTAAATCACTTGTTTAAAA Position: -18 Score: 5.4 Sequence: TTTAAAAAGGATGTTTGAAT Locus tag: SO_2419 Name: fadH Funciton: NADP-dependent 2,4-dienoyl-CoA reductase
	SO_2419	fadH	NADP-dependent 2,4-dienoyl-CoA reductase
Position: -136 Score: 5.5 Sequence: ATTAAAACGCCCGTATGATT Locus tag: SO_2581 Name: fadD1 Funciton: long-chain-fatty-acid--CoA ligase
	SO_2581	fadD1	long-chain-fatty-acid--CoA ligase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of PsrA in Shewanella oneidensis MR-1

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --