Regulon of HrcA in Listeria welshimeri serovar 6b str. SLCC5334

Properties
Regulator type:	Transcription factor
TF locus tag:	lwe1490
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Listeriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 7.3 Sequence: TTAGCACTCTGATGCGTCGAGTGCTAA Locus tag: lwe2090 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: lwe2089 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	lwe2090	groS	Heat shock protein 60 family co-chaperone GroES
	lwe2089	groL	Heat shock protein 60 family chaperone GroEL
Position: -41 Score: 7.4 Sequence: TTAGCACTTGATGTTATTGAGTGCTAA Locus tag: lwe1490 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: lwe1489 Name: grpE Funciton: Heat shock protein GrpE Locus tag: lwe1488 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: lwe1487 Name: dnaJ Funciton: Chaperone protein DnaJ
	lwe1490	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	lwe1489	grpE	Heat shock protein GrpE
	lwe1488	dnaK	Chaperone protein DnaK
	lwe1487	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD