Regulon of HrcA in Listeria monocytogenes EGD-e

Properties
Regulator type:	Transcription factor
TF locus tag:	lmo1475
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Listeriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 7.3 Sequence: TTAGCACTCTGATGTGTCGAGTGCTAA Locus tag: lmo2069 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: lmo2068 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	lmo2069	groS	Heat shock protein 60 family co-chaperone GroES
	lmo2068	groL	Heat shock protein 60 family chaperone GroEL
Position: -41 Score: 7.3 Sequence: TTAGCACTTGACGTTATGGAGTGCTAA Locus tag: lmo1475 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: lmo1474 Name: grpE Funciton: Heat shock protein GrpE Locus tag: lmo1473 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: lmo1472 Name: dnaJ Funciton: Chaperone protein DnaJ
	lmo1475	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	lmo1474	grpE	Heat shock protein GrpE
	lmo1473	dnaK	Chaperone protein DnaK
	lmo1472	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD