Regulon of HrcA in Listeria innocua Clip11262

Properties
Regulator type:	Transcription factor
TF locus tag:	lin1512
Regulator family:	HrcA
Regulation mode:	repressor
Biological process:	Heat shock response
Effector:	Heat shock
Regulog:	HrcA - Listeriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - HrcA
By taxonomy - Listeriaceae
By TF family - HrcA
By effector - Heat shock
By pathway - Heat shock response

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 7.6 Sequence: TTAGCACTCTAATGTGTCGAGTGCTAA Locus tag: lin2175 Name: groS Funciton: Heat shock protein 60 family co-chaperone GroES Locus tag: lin2174 Name: groL Funciton: Heat shock protein 60 family chaperone GroEL
	lin2175	groS	Heat shock protein 60 family co-chaperone GroES
	lin2174	groL	Heat shock protein 60 family chaperone GroEL
Position: -41 Score: 7.5 Sequence: TTAGCACTTGACGTTATTGAGTGCTAA Locus tag: lin1512 Name: hrcA Funciton: Heat shock response transcriptional regulator HrcA, HrcA family Locus tag: lin1511 Name: grpE Funciton: Heat shock protein GrpE Locus tag: lin1510 Name: dnaK Funciton: Chaperone protein DnaK Locus tag: lin1509 Name: dnaJ Funciton: Chaperone protein DnaJ
	lin1512	hrcA	Heat shock response transcriptional regulator HrcA, HrcA family
	lin1511	grpE	Heat shock protein GrpE
	lin1510	dnaK	Chaperone protein DnaK
	lin1509	dnaJ	Chaperone protein DnaJ

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD