Regulon of SCO3812 in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO3812
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Regulog:	SCO3812 - Streptomycetaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - GntR/Others
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -22 Score: 5.5 Sequence: TGGTGATAGTTTCATTAGCACCA Locus tag: SCO3812 Name: SCO3812 Funciton: Transcriptional regulator, GntR family Locus tag: SCO3813 Name: SCO3813 Funciton: putative membrane protein
	SCO3812	SCO3812	Transcriptional regulator, GntR family
	SCO3813	SCO3813	putative membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD