Regulog SCO3812 - Streptomycetaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Streptomyces avermitilis MA-4680
Streptomyces coelicolor A3(2)	2	1
Streptomyces griseus subsp. griseus NBRC 13350	2	1
Streptomyces scabiei 87.22

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
SCO3813	Streptomyces avermitilis MA-4680	Streptomyces coelicolor A3(2) Gene: SCO3813: putative membrane protein	* Streptomyces griseus subsp. griseus NBRC 13350 Site: position = -116 score = 5.52812 sequence = TTGTTCTACTAGCATGCGAACAA Gene: SGR_2260: putative membrane protein	Streptomyces scabiei 87.22	putative membrane protein
SCO3812	Streptomyces avermitilis MA-4680	* Streptomyces coelicolor A3(2) Site: position = -22 score = 5.4609 sequence = TGGTGATAGTTTCATTAGCACCA Gene: SCO3812: Transcriptional regulator, GntR family	Streptomyces griseus subsp. griseus NBRC 13350 Gene: SGR_2259: Transcriptional regulator, GntR family	Streptomyces scabiei 87.22	Transcriptional regulator, GntR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --