Regulon of ManR1 in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_3383
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Regulog:	ManR1 - Shewanellaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Mannose
By pathway - Mannose utilization
By pathway - Mannosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 6.7 Sequence: TTTTTGGAACGTTCCAATTT Locus tag: Shewmr7_3383 Name: manR1 Funciton: Transcriptional regulator of mannoside utilization, LacI family
	Shewmr7_3383	manR1	Transcriptional regulator of mannoside utilization, LacI family
Position: -76 Score: 6.7 Sequence: AAATTGGAACGTTCCAAAAA Locus tag: Shewmr7_3384 Name: mnnA1 Funciton: Alpha-1,2-mannosidase Locus tag: Shewmr7_3385 Name: mnnA2 Funciton: Alpha-1,2-mannosidase Locus tag: Shewmr7_3386 Name: manP1 Funciton: Predicted mannose transporter, GGP family Locus tag: Shewmr7_3387 Name: manK Funciton: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) Locus tag: Shewmr7_3388 Name: manI Funciton: D-mannose isomerase (EC 5.3.1.7)
	Shewmr7_3384	mnnA1	Alpha-1,2-mannosidase
	Shewmr7_3385	mnnA2	Alpha-1,2-mannosidase
	Shewmr7_3386	manP1	Predicted mannose transporter, GGP family
	Shewmr7_3387	manK	Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4)
	Shewmr7_3388	manI	D-mannose isomerase (EC 5.3.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD