Regulog ManR1 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Mannose utilization; Mannosides utilization |
| Effector: | Mannose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - LacI
- By effector - Mannose
- By pathway - Mannose utilization
- By pathway - Mannosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | ||
| Shewanella sp W3-18-1 | ||
| Shewanella sp ANA-3 | ||
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | 6 | 2 |
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | ||
| Shewanella amazonensis SB2B | 6 | 2 |
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| mnnA1 |
|
|
|
|
|
*
Shewanella sp MR-7 Site: position = -76 score = 6.71543 sequence = AAATTGGAACGTTCCAAAAA Gene: Shewmr7_3384: Alpha-1,2-mannosidase |
|
|
|
*
Shewanella amazonensis SB2B Site: position = -76 score = 7.09642 sequence = AAATTGGAACGTTCCAATTG Gene: Sama_0564: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
| mnnA2 |
|
|
|
|
|
Gene: Shewmr7_3385: Alpha-1,2-mannosidase |
|
|
|
Gene: Sama_0563: Alpha-1,2-mannosidase |
|
|
|
|
|
|
Alpha-1,2-mannosidase |
| manP1 |
|
|
|
|
|
Gene: Shewmr7_3386: Predicted mannose transporter, GGP family |
|
|
|
Gene: Sama_0562: Predicted mannose transporter, GGP family |
|
|
|
|
|
|
Predicted mannose transporter, GGP family |
| manK |
|
|
|
|
|
Gene: Shewmr7_3387: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
|
|
|
Gene: Sama_0561: Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
|
|
|
|
|
|
Fructokinase in mannoside utilization gene cluster (EC 2.7.1.4) |
| manI |
|
|
|
|
|
Gene: Shewmr7_3388: D-mannose isomerase (EC 5.3.1.7) |
|
|
|
Gene: Sama_0560: D-mannose isomerase (EC 5.3.1.7) |
|
|
|
|
|
|
D-mannose isomerase (EC 5.3.1.7) |
| CRON 2. | |||||||||||||||||
| manR1 |
|
|
|
|
|
*
Shewanella sp MR-7 Site: position = -103 score = 6.71543 sequence = TTTTTGGAACGTTCCAATTT Gene: Shewmr7_3383: Transcriptional regulator of mannoside utilization, LacI family |
|
|
|
*
Shewanella amazonensis SB2B Site: position = -103 score = 7.09642 sequence = CAATTGGAACGTTCCAATTT Gene: Sama_0565: Transcriptional regulator of mannoside utilization, LacI family |
|
|
|
|
|
|
Transcriptional regulator of mannoside utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |