Profile of regulator ManR1 in Shewanellaceae

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Mannose utilization; Mannosides utilization
Effector:	Mannose
Regulog:	ManR1 - Shewanellaceae

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - LacI
By effector - Mannose
By pathway - Mannose utilization
By pathway - Mannosides utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Shewanella sp MR-7
	Shewmr7_3383	manR1	-103	6.7	TTTTTGGAACGTTCCAATTT
	Shewmr7_3384	mnnA1	-76	6.7	AAATTGGAACGTTCCAAAAA
Shewanella amazonensis SB2B
	Sama_0565	manR1	-103	7.1	CAATTGGAACGTTCCAATTT
	Sama_0564	mnnA1	-76	7.1	AAATTGGAACGTTCCAATTG

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD