Regulon of ScrR in Saccharophagus degradans 2-40

Properties
Regulator type:	Transcription factor
TF locus tag:	Sde_3960
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 6.4 Sequence: AATTACAAACGATTGCAAAA Position: -102 Score: 6.7 Sequence: AATTGCAACCGATTGCAATA Locus tag: Sde_3964 Name: scrT Funciton: Predicted sucrose permease, MFS family, FucP subfamily
	Sde_3964	scrT	Predicted sucrose permease, MFS family, FucP subfamily
Position: -132 Score: 6.7 Sequence: TATTGCAATCGGTTGCAATT Position: -110 Score: 6.4 Sequence: TTTTGCAATCGTTTGTAATT Locus tag: Sde_3963 Name: omp(Scr) Funciton: Predicted sucrose-specific TonB-dependent receptor Locus tag: Sde_3962 Name: scrK Funciton: Fructokinase (EC 2.7.1.4) Locus tag: Sde_3961 Name: Sde_3961 Funciton: Glycosyl hydrolase family 43, five-bladed beta-propellor domain
	Sde_3963	omp(Scr)	Predicted sucrose-specific TonB-dependent receptor
	Sde_3962	scrK	Fructokinase (EC 2.7.1.4)
	Sde_3961	Sde_3961	Glycosyl hydrolase family 43, five-bladed beta-propellor domain

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD