Regulog ScrR - Oceanospirillales/Alteromonadales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Statistics of regulated genes
Genome	Genes	Operons
Cellvibrio japonicus Ueda107
Saccharophagus degradans 2-40	4	2
Teredinibacter turnerae T7901
Marinobacter sp. ELB17
Marinobacter aqueolei
Alcanivorax borkumensis SK2
Chromohalobacter salexigens DSM 3043
Hahella chejuensis KCTC 2396
Marinomonas sp. MWYL1
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Reinekea sp. MED297

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes													Function

CRON 1.
omp(Scr)	Cellvibrio japonicus Ueda107	* Saccharophagus degradans 2-40 Site: position = -110 score = 6.38525 sequence = TTTTGCAATCGTTTGTAATT Site: position = -132 score = 6.74212 sequence = TATTGCAATCGGTTGCAATT Gene: Sde_3963: Predicted sucrose-specific TonB-dependent receptor	Teredinibacter turnerae T7901 Gene: TERTU_3343: Predicted sucrose-specific TonB-dependent receptor	Marinobacter sp. ELB17	Marinobacter aqueolei	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Predicted sucrose-specific TonB-dependent receptor
scrK	Cellvibrio japonicus Ueda107	Saccharophagus degradans 2-40 Gene: Sde_3962: Fructokinase (EC 2.7.1.4)	Teredinibacter turnerae T7901 Gene: TERTU_3342: Fructokinase (EC 2.7.1.4)	Marinobacter sp. ELB17	Marinobacter aqueolei	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Fructokinase (EC 2.7.1.4)
Sde_3961	Cellvibrio japonicus Ueda107	Saccharophagus degradans 2-40 Gene: Sde_3961: Glycosyl hydrolase family 43, five-bladed beta-propellor domain	Teredinibacter turnerae T7901	Marinobacter sp. ELB17	Marinobacter aqueolei	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Glycosyl hydrolase family 43, five-bladed beta-propellor domain
scrT	Cellvibrio japonicus Ueda107	* Saccharophagus degradans 2-40 Site: position = -102 score = 6.74212 sequence = AATTGCAACCGATTGCAATA Site: position = -124 score = 6.38525 sequence = AATTACAAACGATTGCAAAA Gene: Sde_3964: Predicted sucrose permease, MFS family, FucP subfamily	Teredinibacter turnerae T7901 Gene: TERTU_3340: Predicted sucrose permease, MFS family, FucP subfamily	Marinobacter sp. ELB17	Marinobacter aqueolei	Alcanivorax borkumensis SK2	Chromohalobacter salexigens DSM 3043	Hahella chejuensis KCTC 2396	Marinomonas sp. MWYL1	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Reinekea sp. MED297	Predicted sucrose permease, MFS family, FucP subfamily

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog ScrR - Oceanospirillales/Alteromonadales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --