Regulog ScrR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Cellvibrio japonicus Ueda107 | ||
| Saccharophagus degradans 2-40 | 4 | 2 |
| Teredinibacter turnerae T7901 | ||
| Marinobacter sp. ELB17 | ||
| Marinobacter aqueolei | ||
| Alcanivorax borkumensis SK2 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Hahella chejuensis KCTC 2396 | ||
| Marinomonas sp. MWYL1 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Reinekea sp. MED297 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| omp(Scr) |
|
*
Saccharophagus degradans 2-40 Site: position = -110 score = 6.38525 sequence = TTTTGCAATCGTTTGTAATT Site: position = -132 score = 6.74212 sequence = TATTGCAATCGGTTGCAATT Gene: Sde_3963: Predicted sucrose-specific TonB-dependent receptor |
Gene: TERTU_3343: Predicted sucrose-specific TonB-dependent receptor |
|
|
|
|
|
|
|
|
|
Predicted sucrose-specific TonB-dependent receptor |
| scrK |
|
Gene: Sde_3962: Fructokinase (EC 2.7.1.4) |
Gene: TERTU_3342: Fructokinase (EC 2.7.1.4) |
|
|
|
|
|
|
|
|
|
Fructokinase (EC 2.7.1.4) |
| Sde_3961 |
|
Gene: Sde_3961: Glycosyl hydrolase family 43, five-bladed beta-propellor domain |
|
|
|
|
|
|
|
|
|
|
Glycosyl hydrolase family 43, five-bladed beta-propellor domain |
| scrT |
|
*
Saccharophagus degradans 2-40 Site: position = -102 score = 6.74212 sequence = AATTGCAACCGATTGCAATA Site: position = -124 score = 6.38525 sequence = AATTACAAACGATTGCAAAA Gene: Sde_3964: Predicted sucrose permease, MFS family, FucP subfamily |
Gene: TERTU_3340: Predicted sucrose permease, MFS family, FucP subfamily |
|
|
|
|
|
|
|
|
|
Predicted sucrose permease, MFS family, FucP subfamily |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |