Profile of regulator ScrR in Oceanospirillales/Alteromonadales

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Oceanospirillales/Alteromonadales

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Saccharophagus degradans 2-40
	Sde_3964	scrT	-102	6.7	AATTGCAACCGATTGCAATA
	Sde_3964	scrT	-124	6.4	AATTACAAACGATTGCAAAA
	Sde_3963	omp(Scr)	-110	6.4	TTTTGCAATCGTTTGTAATT
	Sde_3963	omp(Scr)	-132	6.7	TATTGCAATCGGTTGCAATT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD