Profile of regulator ScrR in Oceanospirillales/Alteromonadales
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Regulog: | ScrR - Oceanospirillales/Alteromonadales |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Saccharophagus degradans 2-40 | |||||
| Sde_3964 | scrT | -102 | 6.7 | AATTGCAACCGATTGCAATA | |
| Sde_3964 | scrT | -124 | 6.4 | AATTACAAACGATTGCAAAA | |
| Sde_3963 | omp(Scr) | -110 | 6.4 | TTTTGCAATCGTTTGTAATT | |
| Sde_3963 | omp(Scr) | -132 | 6.7 | TATTGCAATCGGTTGCAATT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |