Regulon of VVA0138 in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV21297
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	VVA0138 - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 7.5 Sequence: AAAAGAAAGCGCTTTCTTTT Locus tag: VV21296 Name: VV21296 Funciton: Hypothetical protein
	VV21296	VV21296	Hypothetical protein
Position: -203 Score: 6.6 Sequence: ACAAGCAAGCGCTTTCTTTG Locus tag: VV21297 Name: VV21297 Funciton: Predicted transcriptional regulator, LacI family
	VV21297	VV21297	Predicted transcriptional regulator, LacI family
Position: -229 Score: 6.6 Sequence: CAAAGAAAGCGCTTGCTTGT Position: -57 Score: 7.5 Sequence: AAAAGAAAGCGCTTTCTTTT Locus tag: VV21298 Name: VV21298 Funciton: Exo-beta-1,3-glucanase Locus tag: VV21300 Name: VV21300 Funciton: Beta-glucanase precursor (EC 3.2.1.73)
	VV21298	VV21298	Exo-beta-1,3-glucanase
	VV21300	VV21300	Beta-glucanase precursor (EC 3.2.1.73)
Position: -225 Score: 6.1 Sequence: CCGAGAAAGCGCTTTCTTTG Position: -49 Score: 7.2 Sequence: TAAAGAAAGCGCTTTCTTTT Locus tag: VV21301 Name: VV21301 Funciton: Putative maltoporin
	VV21301	VV21301	Putative maltoporin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD