Regulog VVA0138 - Vibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Photobacterium profundum SS9
Vibrio angustum S14
Vibrio cholerae O1 biovar eltor str. N16961
Vibrio fischeri ES114
Vibrio harveyi ATCC BAA-1116
Vibrio parahaemolyticus RIMD 2210633
Vibrio salmonicida LFI1238
Vibrio shilonii AK1
Vibrio splendidus LGP32
Vibrio vulnificus CMCP6	5	4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
VV21298	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio vulnificus CMCP6 Site: position = -229 score = 6.56967 sequence = CAAAGAAAGCGCTTGCTTGT Site: position = -57 score = 7.48476 sequence = AAAAGAAAGCGCTTTCTTTT Gene: VV21298: Exo-beta-1,3-glucanase	Exo-beta-1,3-glucanase
VV21300	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	Vibrio vulnificus CMCP6 Gene: VV21300: Beta-glucanase precursor (EC 3.2.1.73)	Beta-glucanase precursor (EC 3.2.1.73)

CRON 2.
VV21296	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio vulnificus CMCP6 Site: position = -35 score = 7.48476 sequence = AAAAGAAAGCGCTTTCTTTT Gene: VV21296: Hypothetical protein	Hypothetical protein

CRON 3.
VV21301	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio vulnificus CMCP6 Site: position = -225 score = 6.14693 sequence = CCGAGAAAGCGCTTTCTTTG Site: position = -49 score = 7.17269 sequence = TAAAGAAAGCGCTTTCTTTT Gene: VV21301: Putative maltoporin	Putative maltoporin

CRON 4.
VV21297	Photobacterium profundum SS9	Vibrio angustum S14	Vibrio cholerae O1 biovar eltor str. N16961	Vibrio fischeri ES114	Vibrio harveyi ATCC BAA-1116	Vibrio parahaemolyticus RIMD 2210633	Vibrio salmonicida LFI1238	Vibrio shilonii AK1	Vibrio splendidus LGP32	* Vibrio vulnificus CMCP6 Site: position = -203 score = 6.56967 sequence = ACAAGCAAGCGCTTTCTTTG Gene: VV21297: Predicted transcriptional regulator, LacI family	Predicted transcriptional regulator, LacI family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog VVA0138 - Vibrionales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --