Regulon of CD0683 in Clostridium difficile 630

Properties
Regulator type:	Transcription factor
TF locus tag:	CD0683
Regulator family:	LacI
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	CD0683 - Clostridia-2
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By TF family - LacI

Regulated operons
	Locus Tag	Name	Function
Position: -37 Score: 6.3 Sequence: TTATGCATACGTATTCTGAA Locus tag: CD0680 Name: CD0680 Funciton: Hypothetical protein Locus tag: CD0681 Name: CD0681 Funciton: Predicted transporter, MFS superfamily Locus tag: CD0682 Name: CD0682 Funciton: Putative sugar-sodium symporter Locus tag: CD0683 Name: CD0683 Funciton: Predicted transcriptional regulator, LacI family
	CD0680	CD0680	Hypothetical protein
	CD0681	CD0681	Predicted transporter, MFS superfamily
	CD0682	CD0682	Putative sugar-sodium symporter
	CD0683	CD0683	Predicted transcriptional regulator, LacI family
Position: -119 Score: 6.1 Sequence: AAATGCATATGTATTCATAA Locus tag: CD0679 Name: CD0679 Funciton: Hypothetical protein
	CD0679	CD0679	Hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD